WIPI1 antibody
70R-4358	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1

WIPI1 antibody
70R-4359	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1

WIPI1 siRNA
20-abx939857	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WIPI1 siRNA
20-abx939858	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WIPI1 Polyclonal Antibody
30955-100ul	SAB	100ul	EUR 252

WIPI1 Polyclonal Antibody
30955-50ul	SAB	50ul	EUR 187

WIPI1 Blocking Peptide
33R-5144	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359

WIPI1 Blocking Peptide
33R-1237	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812

Polyclonal WIPI1 Antibody
APR10748G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 . This antibody is tested and proven to work in the following applications:

WIPI1 cloning plasmid
CSB-CL705810HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1341 Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg Show more
Description: A cloning plasmid for the WIPI1 gene.

WIPI1 Rabbit pAb
A7528-100ul	Abclonal	100 ul	EUR 308

WIPI1 Rabbit pAb
A7528-200ul	Abclonal	200 ul	EUR 459

WIPI1 Rabbit pAb
A7528-20ul	Abclonal	20 ul	EUR 183

WIPI1 Rabbit pAb
A7528-50ul	Abclonal	50 ul	EUR 223

WIPI1 Polyclonal Antibody
ABP57486-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide of WIPI1 Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody
ABP57486-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide of WIPI1 Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody
ABP57486-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide of WIPI1 Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody
ES8479-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WIPI1 Polyclonal Antibody
ES8479-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- WIPI1 antibody
FNab09512	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: WD repeat domain, phosphoinositide interacting 1 Uniprot ID: Q5MNZ9 Gene ID: 55062 Research Area: Metabolism
Description: Antibody raised against WIPI1

Anti-WIPI1 antibody
PAab09512	Lifescience Market	100 ug	EUR 412

Anti-WIPI1 antibody
STJ29666	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants.

Anti-WIPI1 antibody
STJ98592	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to WIPI1.

Anti-WIPI1 (3C1)
YF-MA18725	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to WIPI1

Polyclonal WIPI1 Antibody (Center)
APR10749G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications:

Mouse Wipi1 ELISA KIT
ELI-17524m	Lifescience Market	96 Tests	EUR 865

Human WIPI1 ELISA KIT
ELI-17850h	Lifescience Market	96 Tests	EUR 824

WIPI1 ELISA KIT|Human
EF004296	Lifescience Market	96 Tests	EUR 689

Mouse WIPI1 shRNA Plasmid
20-abx974266	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

WIPI1 Polyclonal Conjugated Antibody
C30955	SAB	100ul	EUR 397

Human WIPI1 shRNA Plasmid
20-abx960437	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

WIPI1 Recombinant Protein (Rat)
RP237437	ABM	100 ug	Ask for price

pCMV-SPORT6-WIPI1 Plasmid
PVT16839	Lifescience Market	2 ug	EUR 325

WIPI1 Recombinant Protein (Human)
RP034801	ABM	100 ug	Ask for price

WIPI1 Recombinant Protein (Mouse)
RP185606	ABM	100 ug	Ask for price

Polyclonal WIPI1 Antibody (N-term)
APR10751G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications:

Wipi1 ORF Vector (Mouse) (pORF)
ORF061870	ABM	1.0 ug DNA	EUR 506

Wipi1 ORF Vector (Rat) (pORF)
ORF079147	ABM	1.0 ug DNA	EUR 506

WIPI1 ORF Vector (Human) (pORF)
ORF011601	ABM	1.0 ug DNA	EUR 95

Polyclonal ATG18 / WIPI1 Antibody (C-Terminus)
APG02035G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Wipi1 sgRNA CRISPR Lentivector set (Rat)
K6158301	ABM	3 x 1.0 ug	EUR 339

WIPI1 sgRNA CRISPR Lentivector set (Human)
K2640401	ABM	3 x 1.0 ug	EUR 339

Wipi1 sgRNA CRISPR Lentivector set (Mouse)
K3959601	ABM	3 x 1.0 ug	EUR 339

Monoclonal WIPI1 Antibody (monoclonal) (M02), Clone: 3C1
APR10750G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human WIPI1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C1. This antibody is applicable in WB, E

Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6158302	ABM	1.0 ug DNA	EUR 154

Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6158303	ABM	1.0 ug DNA	EUR 154

Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6158304	ABM	1.0 ug DNA	EUR 154

WIPI1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2640402	ABM	1.0 ug DNA	EUR 154

WIPI1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2640403	ABM	1.0 ug DNA	EUR 154

WIPI1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2640404	ABM	1.0 ug DNA	EUR 154

Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3959602	ABM	1.0 ug DNA	EUR 154

Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3959603	ABM	1.0 ug DNA	EUR 154

Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3959604	ABM	1.0 ug DNA	EUR 154

WIPI1 Protein Vector (Mouse) (pPB-C-His)
PV247478	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Mouse) (pPB-N-His)
PV247479	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Mouse) (pPM-C-HA)
PV247480	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Mouse) (pPM-C-His)
PV247481	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Rat) (pPB-C-His)
PV316586	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Rat) (pPB-N-His)
PV316587	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Rat) (pPM-C-HA)
PV316588	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Rat) (pPM-C-His)
PV316589	ABM	500 ng	EUR 603

WIPI1 Protein Vector (Human) (pPB-C-His)
PV046401	ABM	500 ng	EUR 329

WIPI1 Protein Vector (Human) (pPB-N-His)
PV046402	ABM	500 ng	EUR 329

WIPI1 Protein Vector (Human) (pPM-C-HA)
PV046403	ABM	500 ng	EUR 329

WIPI1 Protein Vector (Human) (pPM-C-His)
PV046404	ABM	500 ng	EUR 329

Wipi1 3'UTR Luciferase Stable Cell Line
TU122310	ABM	1.0 ml	Ask for price

WIPI1 3'UTR GFP Stable Cell Line
TU078498	ABM	1.0 ml	EUR 1394

Wipi1 3'UTR GFP Stable Cell Line
TU172310	ABM	1.0 ml	Ask for price

Wipi1 3'UTR Luciferase Stable Cell Line
TU223410	ABM	1.0 ml	Ask for price

WIPI1 3'UTR Luciferase Stable Cell Line
TU028498	ABM	1.0 ml	EUR 1394

Wipi1 3'UTR GFP Stable Cell Line
TU273410	ABM	1.0 ml	Ask for price

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
20-abx007014	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
20-abx142308	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
abx031393-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
abx031393-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.