WIPI1

WIPI1 antibody
70R-4358 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1
WIPI1 antibody
70R-4359 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1
WIPI1 siRNA
20-abx939857
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WIPI1 siRNA
20-abx939858
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WIPI1 Polyclonal Antibody
30955-100ul 100ul
EUR 252
WIPI1 Polyclonal Antibody
30955-50ul 50ul
EUR 187
WIPI1 Blocking Peptide
33R-5144 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359
WIPI1 Blocking Peptide
33R-1237 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812
Polyclonal WIPI1 Antibody
APR10748G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 . This antibody is tested and proven to work in the following applications:
WIPI1 cloning plasmid
CSB-CL705810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg
  • Show more
Description: A cloning plasmid for the WIPI1 gene.
WIPI1 Rabbit pAb
A7528-100ul 100 ul
EUR 308
WIPI1 Rabbit pAb
A7528-200ul 200 ul
EUR 459
WIPI1 Rabbit pAb
A7528-20ul 20 ul
EUR 183
WIPI1 Rabbit pAb
A7528-50ul 50 ul
EUR 223
WIPI1 Polyclonal Antibody
ABP57486-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1
WIPI1 Polyclonal Antibody
ABP57486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1
WIPI1 Polyclonal Antibody
ABP57486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1
WIPI1 Polyclonal Antibody
ES8479-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
WIPI1 Polyclonal Antibody
ES8479-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
anti- WIPI1 antibody
FNab09512 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: WD repeat domain, phosphoinositide interacting 1
  • Uniprot ID: Q5MNZ9
  • Gene ID: 55062
  • Research Area: Metabolism
Description: Antibody raised against WIPI1
Anti-WIPI1 antibody
PAab09512 100 ug
EUR 412
Anti-WIPI1 antibody
STJ29666 100 µl
EUR 277
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants.
Anti-WIPI1 antibody
STJ98592 200 µl
EUR 197
Description: Rabbit polyclonal to WIPI1.
Anti-WIPI1 (3C1)
YF-MA18725 100 ug
EUR 363
Description: Mouse monoclonal to WIPI1
Polyclonal WIPI1 Antibody (Center)
APR10749G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications:
Mouse Wipi1 ELISA KIT
ELI-17524m 96 Tests
EUR 865
Human WIPI1 ELISA KIT
ELI-17850h 96 Tests
EUR 824
WIPI1 ELISA KIT|Human
EF004296 96 Tests
EUR 689
Mouse WIPI1 shRNA Plasmid
20-abx974266
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WIPI1 Polyclonal Conjugated Antibody
C30955 100ul
EUR 397
Human WIPI1 shRNA Plasmid
20-abx960437
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WIPI1 Recombinant Protein (Rat)
RP237437 100 ug Ask for price
pCMV-SPORT6-WIPI1 Plasmid
PVT16839 2 ug
EUR 325
WIPI1 Recombinant Protein (Human)
RP034801 100 ug Ask for price
WIPI1 Recombinant Protein (Mouse)
RP185606 100 ug Ask for price
Polyclonal WIPI1 Antibody (N-term)
APR10751G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications:
Wipi1 ORF Vector (Mouse) (pORF)
ORF061870 1.0 ug DNA
EUR 506
Wipi1 ORF Vector (Rat) (pORF)
ORF079147 1.0 ug DNA
EUR 506
WIPI1 ORF Vector (Human) (pORF)
ORF011601 1.0 ug DNA
EUR 95
Polyclonal ATG18 / WIPI1 Antibody (C-Terminus)
APG02035G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications:
Wipi1 sgRNA CRISPR Lentivector set (Rat)
K6158301 3 x 1.0 ug
EUR 339
WIPI1 sgRNA CRISPR Lentivector set (Human)
K2640401 3 x 1.0 ug
EUR 339
Wipi1 sgRNA CRISPR Lentivector set (Mouse)
K3959601 3 x 1.0 ug
EUR 339
Monoclonal WIPI1 Antibody (monoclonal) (M02), Clone: 3C1
APR10750G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human WIPI1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C1. This antibody is applicable in WB, E
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6158302 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6158303 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6158304 1.0 ug DNA
EUR 154
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2640402 1.0 ug DNA
EUR 154
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2640403 1.0 ug DNA
EUR 154
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2640404 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3959602 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3959603 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3959604 1.0 ug DNA
EUR 154
WIPI1 Protein Vector (Mouse) (pPB-C-His)
PV247478 500 ng
EUR 603
WIPI1 Protein Vector (Mouse) (pPB-N-His)
PV247479 500 ng
EUR 603
WIPI1 Protein Vector (Mouse) (pPM-C-HA)
PV247480 500 ng
EUR 603
WIPI1 Protein Vector (Mouse) (pPM-C-His)
PV247481 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPB-C-His)
PV316586 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPB-N-His)
PV316587 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPM-C-HA)
PV316588 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPM-C-His)
PV316589 500 ng
EUR 603
WIPI1 Protein Vector (Human) (pPB-C-His)
PV046401 500 ng
EUR 329
WIPI1 Protein Vector (Human) (pPB-N-His)
PV046402 500 ng
EUR 329
WIPI1 Protein Vector (Human) (pPM-C-HA)
PV046403 500 ng
EUR 329
WIPI1 Protein Vector (Human) (pPM-C-His)
PV046404 500 ng
EUR 329
Wipi1 3'UTR Luciferase Stable Cell Line
TU122310 1.0 ml Ask for price
WIPI1 3'UTR GFP Stable Cell Line
TU078498 1.0 ml
EUR 1394
Wipi1 3'UTR GFP Stable Cell Line
TU172310 1.0 ml Ask for price
Wipi1 3'UTR Luciferase Stable Cell Line
TU223410 1.0 ml Ask for price
WIPI1 3'UTR Luciferase Stable Cell Line
TU028498 1.0 ml
EUR 1394
Wipi1 3'UTR GFP Stable Cell Line
TU273410 1.0 ml Ask for price
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
20-abx007014
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
20-abx142308
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
abx031393-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
abx031393-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.