Uba2 Antibody
ABF0287 100 ug
EUR 438
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBA2 antibody
70R-50767 100 ul
EUR 244
Description: Purified Polyclonal UBA2 antibody
UBA2 antibody
70R-21085 50 ul
EUR 435
Description: Rabbit polyclonal UBA2 antibody
UBA2 antibody
70R-30824 100 ug
EUR 327
Description: Rabbit polyclonal UBA2 antibody
Uba2 Antibody
ABD13303 100 ug
EUR 438
Uba2 Antibody
33535-100ul 100ul
EUR 252
Uba2 Antibody
33535-50ul 50ul
EUR 187
UBA2 antibody
10R-6200 100 ul
EUR 726
Description: Mouse monoclonal UBA2 antibody
UBA2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
UBA2 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UBA2 Antibody
CSB-PA096056-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UBA2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Polyclonal Uba2 Antibody
APR05380G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Uba2 . This antibody is tested and proven to work in the following applications:
Uba2 Conjugated Antibody
C33535 100ul
EUR 397
Uba2 Blocking Peptide
AF0287-BP 1mg
EUR 195
anti- UBA2 antibody
FNab09143 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: ubiquitin-like modifier activating enzyme 2
  • Uniprot ID: Q9UBT2
  • Gene ID: 10054
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBA2
UBA2 Polyclonal Antibody
ES3661-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBA2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
UBA2 Polyclonal Antibody
ES3661-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBA2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
UBA2 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
UBA2 Polyclonal Antibody
ABP52662-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of UBA2 from Human. This UBA2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
UBA2 Polyclonal Antibody
ABP52662-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of UBA2 from Human. This UBA2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
UBA2 Polyclonal Antibody
ABP52662-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of UBA2 from Human. This UBA2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
UBA2 Rabbit pAb
A4363-100ul 100 ul
EUR 308
UBA2 Rabbit pAb
A4363-200ul 200 ul
EUR 459
UBA2 Rabbit pAb
A4363-20ul 20 ul Ask for price
UBA2 Rabbit pAb
A4363-50ul 50 ul Ask for price
UBA2 Rabbit pAb
A17342-100ul 100 ul
EUR 308
UBA2 Rabbit pAb
A17342-200ul 200 ul
EUR 459
UBA2 Rabbit pAb
A17342-20ul 20 ul
EUR 183
UBA2 Rabbit pAb
A17342-50ul 50 ul
EUR 223
SAE2/ UBA2 Antibody
49664-100ul 100ul
EUR 333
SAE2/ UBA2 Antibody
49664-50ul 50ul
EUR 239
UBA2 cloning plasmid
CSB-CL890664HU-10ug 10ug
EUR 649
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1923
  • Sequence: atggcactgtcgcgggggctgccccgggagctggctgaggcggtggccgggggccgggtgctggtggtgggggcgggcggcatcggctgcgagctcctcaagaatctcgtgctcaccggtttctcccacatcgacctgattgatctggatactattgatgtaagcaacctcaaca
  • Show more
Description: A cloning plasmid for the UBA2 gene.
Anti-UBA2 antibody
PAab09143 100 ug
EUR 412
Anti-UBA2 antibody
STJ96159 200 µl
EUR 197
Description: Rabbit polyclonal to UBA2.
Anti-UBA2 antibody
STJ26007 100 µl
EUR 277
Anti-UBA2 antibody
STJ119468 100 µl
EUR 277
anti-SAE2 / UBA2
YF-PA16681 50 ug
EUR 363
Description: Mouse polyclonal to SAE2 / UBA2
SAE2/ UBA2 Conjugated Antibody
C49664 100ul
EUR 397
Mouse UBA2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF003978 96 Tests
EUR 689
Human UBA2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-Uba2/Sae2 Antibody
A03816 100ul
EUR 397
Description: Rabbit Polyclonal Uba2/Sae2 Antibody. Validated in IHC, WB and tested in Human.
Anti-SAE2/UBA2 Antibody
A03816-2 100ug/vial
EUR 334
UBA2 Recombinant Protein (Human)
RP033625 100 ug Ask for price
UBA2 Recombinant Protein (Rat)
RP235472 100 ug Ask for price
UBA2 Recombinant Protein (Mouse)
RP182540 100 ug Ask for price
Anti-SAE2 / UBA2 antibody
STJ70427 100 µg
EUR 359
Anti-SAE2 / UBA2 Monoclonal Antibody
M03816 100ug
EUR 397
Description: Rabbit Monoclonal SAE2 / UBA2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Uba2 ORF Vector (Rat) (pORF)
ORF078492 1.0 ug DNA
EUR 506
UBA2 ORF Vector (Human) (pORF)
ORF011209 1.0 ug DNA
EUR 95
Uba2 ORF Vector (Mouse) (pORF)
ORF060848 1.0 ug DNA
EUR 506
Polyclonal SAE2 / UBA2 Antibody (aa160-210)
APR02482G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 / UBA2 (aa160-210). This antibody is tested and proven to work in the following applications:
Polyclonal SAE2 / UBA2 Antibody (C-Terminus)
APR02733G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 / UBA2 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal SAE2 / UBA2 Antibody (aa591-640)
APR02942G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 / UBA2 (aa591-640). This antibody is tested and proven to work in the following applications:
Polyclonal SAE2 / UBA2 Antibody (N-Term)
APG00424G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SAE2 / UBA2 (N-Term). This antibody is tested and proven to work in the following applications:
Uba2 Colorimetric Cell-Based ELISA Kit
EKC1584 100ul
EUR 572
UBA2 sgRNA CRISPR Lentivector set (Human)
K2567301 3 x 1.0 ug
EUR 339
Uba2 sgRNA CRISPR Lentivector set (Rat)
K6129201 3 x 1.0 ug
EUR 339
Uba2 sgRNA CRISPR Lentivector set (Mouse)
K4894501 3 x 1.0 ug
EUR 339
Anti-SAE2/UBA2 Antibody (monoclonal, 5H11)
M03816-1 100ug/vial
EUR 294
Anti-SAE2/UBA2 Antibody (monoclonal, 5B13)
M03816-2 100ug/vial
EUR 334
Polyclonal SAE2 (UBA2) Antibody (C-term E616)
APR03461G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 (UBA2) (C-term E616). This antibody is tested and proven to work in the following applications:
UBA2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2567302 1.0 ug DNA
EUR 154
UBA2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2567303 1.0 ug DNA
EUR 154
UBA2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2567304 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6129202 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6129203 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6129204 1.0 ug DNA
EUR 154
Human SUMO-activating enzyme subunit 2 (UBA2)
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 84.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human SUMO-activating enzyme subunit 2(UBA2) expressed in E.coli
Uba2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4894502 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4894503 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4894504 1.0 ug DNA
EUR 154