Product not found


Product not found


Human Histone Deacetylase 3 (HDAC3) ELISA kit

DLR-HDAC3-Hu-96T 96T
EUR 673
  • Should the Human Histone Deacetylase 3 (HDAC3) ELISA kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histone Deacetylase 3 (HDAC3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-48Tests 48 Tests
EUR 544

Human Histone Deacetylase 3 (HDAC3) ELISA kit

RDR-HDAC3-Hu-96Tests 96 Tests
EUR 756

Hdac3/ Rat Hdac3 ELISA Kit

ELI-27737r 96 Tests
EUR 886

HDAC3 antibody

20R-2774 50 ug
EUR 281
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody  

21660-100ul 100ul
EUR 252

HDAC3 Antibody  

21660-50ul 50ul
EUR 187

HDAC3 Antibody

31216-100ul 100ul
EUR 252

HDAC3 Antibody

31216-50ul 50ul
EUR 187

HDAC3 antibody

70R-17706 50 ul
EUR 435
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-11943 100 ug
EUR 403
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody

70R-31225 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

EUR 338

HDAC3 Antibody

EUR 146

HDAC3 antibody

70R-14137 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody

33400-100ul 100ul
EUR 252

HDAC3 Antibody

33400-50ul 50ul
EUR 187

HDAC3 Antibody

EUR 316

HDAC3 Antibody

EUR 146

HDAC3 Antibody

32620-100ul 100ul
EUR 252

HDAC3 antibody

10R-2003 100 ul
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-2004 100 ul
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody

10R-10389 100 ug
EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody

48964-100ul 100ul
EUR 333

HDAC3 Antibody

48964-50ul 50ul
EUR 239

HDAC3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

CSB-PA916163-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

CSB-PA967736-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody

DF6862 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

Hdac3 antibody

70R-8546 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 antibody

70R-33611 100 ug
EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Protein

E24006 50 µg
EUR 806.9
Description: fast delivery possible

HDAC3 Antibody

AF0733 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Antibody

AF5349 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

AF6016 200ul
EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

BF0230 200ul
EUR 376
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDAC3 Antibody

ABF5349 100 ug
EUR 438

HDAC3 Antibody

ABF6016 100 ug
EUR 438

HDAC3 Antibody

ABD6862 100 ug
EUR 438

HDAC3 Antibody

ABF0733 100 ug
EUR 438


PVT18724 2 ug
EUR 231


YF-PA15910 50 ul
EUR 363
Description: Mouse polyclonal to HDAC3


YF-PA15911 100 ul
EUR 403
Description: Rabbit polyclonal to HDAC3


YF-PA15912 100 ug
EUR 403
Description: Rabbit polyclonal to HDAC3


YF-PA25204 50 ul
EUR 334
Description: Mouse polyclonal to HDAC3


YF-PA25205 50 ul
EUR 334
Description: Mouse polyclonal to HDAC3

HDAC3 Monoclonal Antibody

27125-100ul 100ul
EUR 252

HDAC3 Monoclonal Antibody

27125-50ul 50ul
EUR 187

HDAC3 Rabbit pAb

A12542-100ul 100 ul
EUR 308

HDAC3 Rabbit pAb

A12542-200ul 200 ul
EUR 459

HDAC3 Rabbit pAb

A12542-20ul 20 ul
EUR 183

HDAC3 Rabbit pAb

A12542-50ul 50 ul
EUR 223



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAT2 antibody

70R-36685 100 ug
EUR 327
Description: Rabbit Polyclonal GNAT2 antibody

GNAT2 Antibody

ABD13114 100 ug
EUR 438

GNAT2 Antibody

ABD4110 100 ug
EUR 438

GNAT2 Antibody

34729-100ul 100ul
EUR 252

GNAT2 Antibody

34729-50ul 50ul
EUR 187

GNAT2 antibody

23007-100ul 100ul
EUR 390

GNAT2 antibody

70R-13601 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAT2 antibody

GNAT2 Antibody

DF4110 200ul
EUR 304
Description: GNAT2 Antibody detects endogenous levels of total GNAT2.

GNAT2 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody

CSB-PA237874-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GNAT2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GNAT2 Conjugated Antibody

C34729 100ul
EUR 397

GNAT2 cloning plasmid

CSB-CL009599HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgggaagtggagccagtgctgaggacaaagaactggccaagaggtccaaggagctagaaaagaagctgcaggaggatgctgataaggaagccaagactgtcaagctgctactgctgggtgctggggagtcaggaaagagcaccatcgtcaaacagatgaagatcattcaccagg
  • Show more
Description: A cloning plasmid for the GNAT2 gene.

Anti-GNAT2 Antibody

A06518 100ul
EUR 397
Description: Rabbit Polyclonal GNAT2 Antibody. Validated in WB and tested in Human, Mouse.

GNAT2 Rabbit pAb

A10352-100ul 100 ul
EUR 308

GNAT2 Rabbit pAb

A10352-200ul 200 ul
EUR 459

GNAT2 Rabbit pAb

A10352-20ul 20 ul
EUR 183

GNAT2 Rabbit pAb

A10352-50ul 50 ul
EUR 223

GNAT2 Blocking Peptide

DF4110-BP 1mg
EUR 195

pENTR223-GNAT2 vector

PVT12001 2 ug
EUR 308

Anti-GNAT2 antibody

STJ112390 100 µl
EUR 277
Description: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones.

Polyclonal GNAT2 Antibody (Center)

APR12053G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAT2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Gnat2 ELISA KIT

ELI-27344m 96 Tests
EUR 865


ELI-43684h 96 Tests
EUR 824


ELI-31794b 96 Tests
EUR 928

Mouse GNAT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAT2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAT2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAT2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAT2 Recombinant Protein (Human)

RP013492 100 ug Ask for price

GNAT2 Recombinant Protein (Rat)

RP202979 100 ug Ask for price

GNAT2 Recombinant Protein (Mouse)

RP138947 100 ug Ask for price

GNAT2 ORF Vector (Human) (pORF)

ORF004498 1.0 ug DNA
EUR 95

Gnat2 ORF Vector (Rat) (pORF)

ORF067661 1.0 ug DNA
EUR 506

Gnat2 ORF Vector (Mouse) (pORF)

ORF046317 1.0 ug DNA
EUR 506

GNAT2 sgRNA CRISPR Lentivector set (Human)

K0875601 3 x 1.0 ug
EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Mouse)

K3838901 3 x 1.0 ug
EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Rat)

K6721101 3 x 1.0 ug
EUR 339

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0875602 1.0 ug DNA
EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0875603 1.0 ug DNA
EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0875604 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3838902 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3838903 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3838904 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6721102 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6721103 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6721104 1.0 ug DNA
EUR 154

GNAT2 Protein Vector (Mouse) (pPB-C-His)

PV185266 500 ng
EUR 603

GNAT2 Protein Vector (Mouse) (pPB-N-His)

PV185267 500 ng
EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-HA)

PV185268 500 ng
EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-His)

PV185269 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPB-C-His)

PV270642 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPB-N-His)

PV270643 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-HA)

PV270644 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-His)

PV270645 500 ng
EUR 603

GNAT2 Protein Vector (Human) (pPB-C-His)

PV017989 500 ng
EUR 329

GNAT2 Protein Vector (Human) (pPB-N-His)

PV017990 500 ng
EUR 329



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAT3 Antibody

37600-100ul 100ul
EUR 252

GNAT3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAT3. Recognizes GNAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GNAT3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAT3. Recognizes GNAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GNAT3 Conjugated Antibody

C37600 100ul
EUR 397

GNAT3 Rabbit pAb

A15982-100ul 100 ul
EUR 308

GNAT3 Rabbit pAb

A15982-200ul 200 ul
EUR 459

GNAT3 Rabbit pAb

A15982-20ul 20 ul
EUR 183

GNAT3 Rabbit pAb

A15982-50ul 50 ul
EUR 223

Anti-GNAT3 antibody

STJ71398 100 µg
EUR 359

Anti-GNAT3 antibody

STJ118441 100 µl
EUR 277

Rat GNAT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-27252h 96 Tests
EUR 824

Mouse Gnat3 ELISA KIT

ELI-47243m 96 Tests
EUR 865


ELI-48773b 96 Tests
EUR 928

Human GNAT3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAT3 Recombinant Protein (Human)

RP060753 100 ug Ask for price

GNAT3 Recombinant Protein (Rat)

RP202982 100 ug Ask for price

GNAT3 Recombinant Protein (Mouse)

RP138950 100 ug Ask for price

Polyclonal GNAT3 / Gustducin Antibody (Internal)

APR12054G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAT3 / Gustducin (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal GNAT3 Antibody (internal region)

APR12055G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAT3 (internal region). This antibody is tested and proven to work in the following applications:

Gnat3 ORF Vector (Rat) (pORF)

ORF067662 1.0 ug DNA
EUR 506

Gnat3 ORF Vector (Mouse) (pORF)

ORF046318 1.0 ug DNA
EUR 506

GNAT3 ORF Vector (Human) (pORF)

ORF020252 1.0 ug DNA
EUR 405

GNAT3 sgRNA CRISPR Lentivector set (Human)

K0875701 3 x 1.0 ug
EUR 339

Gnat3 sgRNA CRISPR Lentivector set (Mouse)

K3899001 3 x 1.0 ug
EUR 339

Gnat3 sgRNA CRISPR Lentivector set (Rat)

K7362501 3 x 1.0 ug
EUR 339

GNAT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0875702 1.0 ug DNA
EUR 154

GNAT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0875703 1.0 ug DNA
EUR 154

GNAT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0875704 1.0 ug DNA
EUR 154

Gnat3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3899002 1.0 ug DNA
EUR 154

Gnat3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3899003 1.0 ug DNA
EUR 154

Gnat3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3899004 1.0 ug DNA
EUR 154

Gnat3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7362502 1.0 ug DNA
EUR 154

Gnat3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7362503 1.0 ug DNA
EUR 154

Gnat3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7362504 1.0 ug DNA
EUR 154

GNAT3 Protein Vector (Human) (pPB-C-His)

PV081005 500 ng
EUR 552

GNAT3 Protein Vector (Human) (pPB-N-His)

PV081006 500 ng
EUR 552

GNAT3 Protein Vector (Human) (pPM-C-HA)

PV081007 500 ng
EUR 552

GNAT3 Protein Vector (Human) (pPM-C-His)

PV081008 500 ng
EUR 552

GNAT3 Protein Vector (Mouse) (pPB-C-His)

PV185270 500 ng
EUR 603

GNAT3 Protein Vector (Mouse) (pPB-N-His)

PV185271 500 ng
EUR 603

GNAT3 Protein Vector (Mouse) (pPM-C-HA)

PV185272 500 ng
EUR 603

GNAT3 Protein Vector (Mouse) (pPM-C-His)

PV185273 500 ng
EUR 603

GNAT3 Protein Vector (Rat) (pPB-C-His)

PV270646 500 ng
EUR 603

GNAT3 Protein Vector (Rat) (pPB-N-His)

PV270647 500 ng
EUR 603

GNAT3 Protein Vector (Rat) (pPM-C-HA)

PV270648 500 ng
EUR 603

GNAT3 Protein Vector (Rat) (pPM-C-His)

PV270649 500 ng
EUR 603

Gnat3 3'UTR Luciferase Stable Cell Line

TU205214 1.0 ml Ask for price

Gnat3 3'UTR GFP Stable Cell Line

TU158855 1.0 ml Ask for price

GNAT3 3'UTR Luciferase Stable Cell Line

TU008981 1.0 ml
EUR 2333

Gnat3 3'UTR Luciferase Stable Cell Line

TU108855 1.0 ml Ask for price

GNAT3 3'UTR GFP Stable Cell Line

TU058981 1.0 ml
EUR 2333

Gnat3 3'UTR GFP Stable Cell Line

TU255214 1.0 ml Ask for price

G Protein Subunit Alpha Transducin 3 (GNAT3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Subunit Alpha Transducin 3 (GNAT3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GNAT3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV676201 1.0 ug DNA
EUR 682



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG12 antibody

70R-51389 100 ul
EUR 244
Description: Purified Polyclonal GNG12 antibody

GNG12 Antibody

46003-100ul 100ul
EUR 252

GNG12 Antibody

46003-50ul 50ul
EUR 187

GNG12 Antibody

DF9556 200ul
EUR 304
Description: GNG12 Antibody detects endogenous levels of total GNG12.

GNG12 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNG12 Conjugated Antibody

C46003 100ul
EUR 397

GNG12 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human GNG12 Antibody

32775-05111 150 ug
EUR 261

GNG12 cloning plasmid

CSB-CL883362HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 219
  • Sequence: atgtccagcaaaacagcaagcaccaacaatatagcccaggcaaggagaactgtgcagcagttaagattagaagcctccattgaaggaataaaggtttcgaaggcatcagcggacctcatgtcctactgtgaggaacatgccaggagtgaccctttgctgataggaataccaacttc
  • Show more
Description: A cloning plasmid for the GNG12 gene.

GNG12 Blocking Peptide

DF9556-BP 1mg
EUR 195

Mouse Gng12 ELISA KIT

ELI-27207m 96 Tests
EUR 865


ELI-47373h 96 Tests
EUR 824


ELI-32426b 96 Tests
EUR 928

GNG12 protein (His tag)

80R-4135 100 ug
EUR 327
Description: Recombinant Human GNG12 protein (His tag)

Mouse GNG12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG12 Recombinant Protein (Human)

RP013540 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139001 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139004 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139007 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139010 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139013 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139016 100 ug Ask for price

Polyclonal GNG12 Antibody (C-Term)

APR04951G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG12 (C-Term). This antibody is tested and proven to work in the following applications:

Human GNG12 Antibody (Biotin Conjugate)

32775-05121 150 ug
EUR 369

Human GNG12 Antibody (APC Conjguate)

32775-05161 150 ug
EUR 428

GNG12 ORF Vector (Human) (pORF)

ORF004514 1.0 ug DNA
EUR 95

Gng12 ORF Vector (Mouse) (pORF)

ORF046335 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046336 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046337 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046338 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046339 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046340 1.0 ug DNA
EUR 506

GNG12 sgRNA CRISPR Lentivector set (Human)

K0877901 3 x 1.0 ug
EUR 339

Human GNG12 AssayLite Antibody (FITC Conjugate)

32775-05141 150 ug
EUR 428

Human GNG12 AssayLite Antibody (RPE Conjugate)

32775-05151 150 ug
EUR 428

Human GNG12 AssayLite Antibody (PerCP Conjugate)

32775-05171 150 ug
EUR 471

Gng12 sgRNA CRISPR Lentivector set (Mouse)

K4904001 3 x 1.0 ug
EUR 339

GNG12 sgRNA CRISPR Lentivector (Human) (Target 1)

K0877902 1.0 ug DNA
EUR 154

GNG12 sgRNA CRISPR Lentivector (Human) (Target 2)

K0877903 1.0 ug DNA
EUR 154

GNG12 sgRNA CRISPR Lentivector (Human) (Target 3)

K0877904 1.0 ug DNA
EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4904002 1.0 ug DNA
EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4904003 1.0 ug DNA
EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4904004 1.0 ug DNA
EUR 154

GNG12 Protein Vector (Mouse) (pPB-C-His)

PV185338 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)

PV185339 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)

PV185340 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-His)

PV185341 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-C-His)

PV185342 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)

PV185343 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)

PV185344 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-His)

PV185345 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-C-His)

PV185346 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)

PV185347 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)

PV185348 500 ng
EUR 603


GNGT2 antibody

70R-3637 50 ug
EUR 467
Description: Rabbit polyclonal GNGT2 antibody raised against the middle region of Gngt2

GNGT2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNGT2 Rabbit pAb

A13992-100ul 100 ul
EUR 308

GNGT2 Rabbit pAb

A13992-200ul 200 ul
EUR 459

GNGT2 Rabbit pAb

A13992-20ul 20 ul
EUR 183

GNGT2 Rabbit pAb

A13992-50ul 50 ul
EUR 223

GNGT2 Blocking Peptide

33R-4362 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNGT2 antibody, catalog no. 70R-3637

GNGT2 Conjugated Antibody

C47622 100ul
EUR 397

GNGT2 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNGT2 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNGT2 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNGT2 cloning plasmid

CSB-CL009622HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 210
  • Sequence: atggcccaggatctcagcgagaaggacctgttgaagatggaggtggagcagctgaagaaagaagtgaaaaacacaagaattccgatttccaaagcgggaaaggaaatcaaggagtacgtggaggcccaagcaggaaacgatccttttctcaaaggcatccctgaggacaagaatcc
  • Show more
Description: A cloning plasmid for the GNGT2 gene.

GNGT2 Rabbit pAb

A9818-100ul 100 ul
EUR 308

GNGT2 Rabbit pAb

A9818-200ul 200 ul
EUR 459

GNGT2 Rabbit pAb

A9818-20ul 20 ul
EUR 183

GNGT2 Rabbit pAb

A9818-50ul 50 ul
EUR 223

GNGT2 Polyclonal Antibody

A59270 100 µg
EUR 570.55
Description: kits suitable for this type of research


PVT12817 2 ug
EUR 391

Anti-GNGT2 antibody

STJ111860 100 µl
EUR 277
Description: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene.

Anti-GNGT2 antibody

STJ115927 100 µl
EUR 277
Description: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene.


ELI-21492b 96 Tests
EUR 928

Mouse Gngt2 ELISA KIT

ELI-27210m 96 Tests
EUR 865

GNGT2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNGT2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNGT2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNGT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNGT2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-32428h 96 Tests
EUR 824


ELI-47376d 96 Tests
EUR 928

GNGT2 Recombinant Protein (Human)

RP013561 100 ug Ask for price

GNGT2 Recombinant Protein (Rat)

RP203039 100 ug Ask for price

GNGT2 Recombinant Protein (Mouse)

RP139049 100 ug Ask for price

GNGT2 Recombinant Protein (Mouse)

RP139052 100 ug Ask for price

GNGT2 Polyclonal Antibody, Biotin Conjugated

A59271 100 µg
EUR 570.55
Description: fast delivery possible

GNGT2 Polyclonal Antibody, FITC Conjugated

A59272 100 µg
EUR 570.55
Description: reagents widely cited

GNGT2 Polyclonal Antibody, HRP Conjugated

A59273 100 µg
EUR 570.55
Description: Ask the seller for details

Gngt2 ORF Vector (Rat) (pORF)

ORF067681 1.0 ug DNA
EUR 506

GNGT2 ORF Vector (Human) (pORF)

ORF004521 1.0 ug DNA
EUR 95

Gngt2 ORF Vector (Mouse) (pORF)

ORF046351 1.0 ug DNA
EUR 506

Gngt2 ORF Vector (Mouse) (pORF)

ORF046352 1.0 ug DNA
EUR 506

Gngt2 sgRNA CRISPR Lentivector set (Rat)

K6576801 3 x 1.0 ug
EUR 339

Gngt2 sgRNA CRISPR Lentivector set (Mouse)

K4579001 3 x 1.0 ug
EUR 339

GNGT2 sgRNA CRISPR Lentivector set (Human)

K0878201 3 x 1.0 ug
EUR 339

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6576802 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6576803 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6576804 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4579002 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4579003 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4579004 1.0 ug DNA
EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0878202 1.0 ug DNA
EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0878203 1.0 ug DNA
EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0878204 1.0 ug DNA
EUR 154

GNGT2 Protein Vector (Rat) (pPB-C-His)

PV270722 500 ng
EUR 603

GNGT2 Protein Vector (Rat) (pPB-N-His)

PV270723 500 ng
EUR 603

GNGT2 Protein Vector (Rat) (pPM-C-HA)

PV270724 500 ng
EUR 603

GNGT2 Protein Vector (Rat) (pPM-C-His)

PV270725 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPB-C-His)

PV185402 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPB-N-His)

PV185403 500 ng
EUR 603



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GOSR1 antibody

70R-35248 100 ug
EUR 327
Description: Purified Rabbit polyclonal GOSR1 antibody

GOSR1 antibody

70R-9802 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GOSR1 antibody

GOSR1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GOSR1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

GOSR1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GOSR1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000


YF-PA16364 50 ul
EUR 363
Description: Mouse polyclonal to GOSR1


YF-PA16365 50 ug
EUR 363
Description: Mouse polyclonal to GOSR1


YF-PA16366 100 ul
EUR 403
Description: Rabbit polyclonal to GOSR1

GOSR1 cloning plasmid

CSB-CL009677HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 528
  • Sequence: atggcggcagggaccagcagttactgggaagatctcaggaaacaggctcgacagctggaaaatgaacttgacctgaaactagtttccttcagcaaactatgtacaagttacagtcatagcagtacccgagatggaagacgcgacaggtatagttctgatacaacaccccttttaaa
  • Show more
Description: A cloning plasmid for the GOSR1 gene.

GOSR1 Rabbit pAb

A4316-100ul 100 ul
EUR 308

GOSR1 Rabbit pAb

A4316-200ul 200 ul
EUR 459

GOSR1 Rabbit pAb

A4316-20ul 20 ul
EUR 183

GOSR1 Rabbit pAb

A4316-50ul 50 ul
EUR 223

GOSR1 Blocking Peptide

33R-3986 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GOSR1 antibody, catalog no. 70R-9802

GOSR1 Polyclonal Antibody

30545-100ul 100ul
EUR 252

GOSR1 Polyclonal Antibody

30545-50ul 50ul
EUR 187

Anti-GOSR1 antibody

STJ23876 100 µl
EUR 277
Description: This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-GOSR1 (2C2)

YF-MA16894 100 ug
EUR 363
Description: Mouse monoclonal to GOSR1

GOSR1 Polyclonal Conjugated Antibody

C30545 100ul
EUR 397

Mouse GOSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GOSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GOSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-GOSR1/Gs28 Antibody

A09064 100ul
EUR 397
Description: Rabbit Polyclonal GOSR1/Gs28 Antibody. Validated in WB and tested in Human.

GOSR1 Recombinant Protein (Human)

RP013663 100 ug Ask for price

GOSR1 Recombinant Protein (Rat)

RP203135 100 ug Ask for price

GOSR1 Recombinant Protein (Mouse)

RP139184 100 ug Ask for price

GOSR1 ORF Vector (Human) (pORF)

ORF004555 1.0 ug DNA
EUR 95

Gosr1 ORF Vector (Rat) (pORF)

ORF067713 1.0 ug DNA
EUR 506

Gosr1 ORF Vector (Mouse) (pORF)

ORF046396 1.0 ug DNA
EUR 506

GOSR1 sgRNA CRISPR Lentivector set (Human)

K0883901 3 x 1.0 ug
EUR 339

Gosr1 sgRNA CRISPR Lentivector set (Mouse)

K3051901 3 x 1.0 ug
EUR 339

Gosr1 sgRNA CRISPR Lentivector set (Rat)

K7080601 3 x 1.0 ug
EUR 339

GOSR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0883902 1.0 ug DNA
EUR 154

GOSR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0883903 1.0 ug DNA
EUR 154

GOSR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0883904 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3051902 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3051903 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3051904 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7080602 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7080603 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7080604 1.0 ug DNA
EUR 154

GOSR1 Protein Vector (Mouse) (pPB-C-His)

PV185582 500 ng
EUR 603

GOSR1 Protein Vector (Mouse) (pPB-N-His)

PV185583 500 ng
EUR 603

GOSR1 Protein Vector (Mouse) (pPM-C-HA)

PV185584 500 ng
EUR 603

GOSR1 Protein Vector (Mouse) (pPM-C-His)

PV185585 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPB-C-His)

PV270850 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPB-N-His)

PV270851 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPM-C-HA)

PV270852 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPM-C-His)

PV270853 500 ng
EUR 603

GOSR1 Protein Vector (Human) (pPB-C-His)

PV018217 500 ng
EUR 329

GOSR1 Protein Vector (Human) (pPB-N-His)

PV018218 500 ng
EUR 329

GOSR1 Protein Vector (Human) (pPM-C-HA)

PV018219 500 ng
EUR 329

GOSR1 Protein Vector (Human) (pPM-C-His)

PV018220 500 ng
EUR 329

Gosr1 3'UTR Luciferase Stable Cell Line

TU205270 1.0 ml Ask for price

Gosr1 3'UTR GFP Stable Cell Line

TU158910 1.0 ml Ask for price

GOSR1 3'UTR Luciferase Stable Cell Line

TU009083 1.0 ml
EUR 2333


eIF4E Antibody

AF6110 200ul
EUR 304
Description: eIF4E Antibody detects endogenous levels of total eIF4E.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4E Antibody

BF0279 200ul
EUR 376
Description: EIF4E antibody detects endogenous levels of total EIF4E.

eIF4E Antibody

AF7702 200ul
EUR 376
Description: eIF4E Antibody detects endogenous levels of eIF4E.

eIF4E Antibody

ABF6110 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4E antibody

70R-49697 100 ul
EUR 244
Description: Purified Polyclonal EIF4E antibody

EIF4E antibody
