Category: Epitope

Product not found

Product not found

Human Histone Deacetylase 3 (HDAC3) ELISA kit
DLR-HDAC3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Histone Deacetylase 3 (HDAC3) ELISA kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histone Deacetylase 3 (HDAC3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Histone Deacetylase 3 (HDAC3) ELISA kit
RDR-HDAC3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Histone Deacetylase 3 (HDAC3) ELISA kit
RDR-HDAC3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Hdac3/ Rat Hdac3 ELISA Kit
ELI-27737r	Lifescience Market	96 Tests	EUR 886

HDAC3 Antibody
AF5349	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
AF6016	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
BF0230	Affbiotech	200ul	EUR 376
Description: HDAC3 antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
AF0733	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of HDAC3.

HDAC3 Protein
E24006	EpiGentek	50 µg	EUR 806.9
Description: fast delivery possible

HDAC3 Antibody
ABF5349	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABF6016	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
ABF0733	Lifescience Market	100 ug	EUR 438

HDAC3 siRNA
20-abx919179	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDAC3 siRNA
20-abx919180	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDAC3 antibody
70R-33611	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-31225	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HDAC3 antibody

Hdac3 antibody
70R-8546	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Hdac3 antibody

HDAC3 Antibody
ABD6862	Lifescience Market	100 ug	EUR 438

HDAC3 Antibody
3603-100	Biovision		EUR 316

HDAC3 Antibody
3603-30T	Biovision		EUR 146

HDAC3 Antibody
33400-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
33400-50ul	SAB	50ul	EUR 187

HDAC3 Antibody
48964-100ul	SAB	100ul	EUR 333

HDAC3 Antibody
48964-50ul	SAB	50ul	EUR 239

HDAC3 antibody
10R-10389	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 Antibody
31216-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
31216-50ul	SAB	50ul	EUR 187

HDAC3 Antibody
32620-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
21660-100ul	SAB	100ul	EUR 252

HDAC3 Antibody
21660-50ul	SAB	50ul	EUR 187

HDAC3 antibody
10R-2003	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody
10R-2004	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HDAC3 antibody

HDAC3 antibody
20R-2774	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
6603-100	Biovision		EUR 338

HDAC3 Antibody
6603-30T	Biovision		EUR 146

HDAC3 antibody
70R-17706	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-11943	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal HDAC3 antibody

HDAC3 antibody
70R-14137	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal HDAC3 antibody

HDAC3 Antibody
DF6862	Affbiotech	200ul	EUR 304
Description: HDAC3 Antibody detects endogenous levels of total HDAC3.

HDAC3 Antibody
1-CSB-PA899967	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HDAC3 Antibody
CSB-PA916163-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody
CSB-PA916163-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

HDAC3 Antibody
CSB-PA967736-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody
CSB-PA967736-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

HDAC3 Antibody
1-CSB-PA002880	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HDAC3 Antibody
1-CSB-PA004117	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HDAC3 Antibody
1-CSB-PA010239GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDAC3 Antibody
1-CSB-PA010239LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDAC3. Recognizes HDAC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

pOTB7-HDAC3
PVT18724	Lifescience Market	2 ug	EUR 231

anti-HDAC3
YF-PA15910	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HDAC3

anti-HDAC3
YF-PA15911	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3
YF-PA15912	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HDAC3

anti-HDAC3
YF-PA25204	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDAC3

anti-HDAC3
YF-PA25205	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDAC3

HDAC3 Blocking Peptide
AF5349-BP	Affbiotech	1mg	EUR 195

HDAC3 Blocking Peptide
AF6016-BP	Affbiotech	1mg	EUR 195

Polyclonal HDAC3 Antibody
AMM05315G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC3 Antibody
AMM05316G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC3 . This antibody is tested and proven to work in the following applications:

Monoclonal HDAC3 Antibody
AMM05317G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human HDAC3. The antibodies are raised in Mouse. This antibody is applicable in WB

HDAC3 Blocking Peptide
BF0230-BP	Affbiotech	1mg	EUR 195

GNAT2 siRNA
20-abx918165	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAT2 antibody
70R-36685	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal GNAT2 antibody

GNAT2 Antibody
ABD13114	Lifescience Market	100 ug	EUR 438

GNAT2 Antibody
ABD4110	Lifescience Market	100 ug	EUR 438

GNAT2 Antibody
34729-100ul	SAB	100ul	EUR 252

GNAT2 Antibody
34729-50ul	SAB	50ul	EUR 187

GNAT2 antibody
23007-100ul	SAB	100ul	EUR 390

GNAT2 antibody
70R-13601	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAT2 antibody

GNAT2 Antibody
DF4110	Affbiotech	200ul	EUR 304
Description: GNAT2 Antibody detects endogenous levels of total GNAT2.

GNAT2 Antibody
CSB-PA237874-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody
CSB-PA237874-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody
1-CSB-PA008888	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GNAT2 Antibody
1-CSB-PA009599LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GNAT2 Conjugated Antibody
C34729	SAB	100ul	EUR 397

GNAT2 cloning plasmid
CSB-CL009599HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1065 Sequence: atgggaagtggagccagtgctgaggacaaagaactggccaagaggtccaaggagctagaaaagaagctgcaggaggatgctgataaggaagccaagactgtcaagctgctactgctgggtgctggggagtcaggaaagagcaccatcgtcaaacagatgaagatcattcaccagg Show more
Description: A cloning plasmid for the GNAT2 gene.

Anti-GNAT2 Antibody
A06518	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GNAT2 Antibody. Validated in WB and tested in Human, Mouse.

GNAT2 Rabbit pAb
A10352-100ul	Abclonal	100 ul	EUR 308

GNAT2 Rabbit pAb
A10352-200ul	Abclonal	200 ul	EUR 459

GNAT2 Rabbit pAb
A10352-20ul	Abclonal	20 ul	EUR 183

GNAT2 Rabbit pAb
A10352-50ul	Abclonal	50 ul	EUR 223

GNAT2 Blocking Peptide
DF4110-BP	Affbiotech	1mg	EUR 195

pENTR223-GNAT2 vector
PVT12001	Lifescience Market	2 ug	EUR 308

Anti-GNAT2 antibody
STJ112390	St John's Laboratory	100 µl	EUR 277
Description: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones.

Polyclonal GNAT2 Antibody (Center)
APR12053G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAT2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Gnat2 ELISA KIT
ELI-27344m	Lifescience Market	96 Tests	EUR 865

Human GNAT2 ELISA KIT
ELI-43684h	Lifescience Market	96 Tests	EUR 824

Bovine GNAT2 ELISA KIT
ELI-31794b	Lifescience Market	96 Tests	EUR 928

Mouse GNAT2 shRNA Plasmid
20-abx970585	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAT2 shRNA Plasmid
20-abx951852	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNAT2 Antibody, HRP conjugated
1-CSB-PA009599LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAT2 Antibody, FITC conjugated
1-CSB-PA009599LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAT2 Antibody, Biotin conjugated
1-CSB-PA009599LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAT2 Recombinant Protein (Human)
RP013492	ABM	100 ug	Ask for price

GNAT2 Recombinant Protein (Rat)
RP202979	ABM	100 ug	Ask for price

GNAT2 Recombinant Protein (Mouse)
RP138947	ABM	100 ug	Ask for price

GNAT2 ORF Vector (Human) (pORF)
ORF004498	ABM	1.0 ug DNA	EUR 95

Gnat2 ORF Vector (Rat) (pORF)
ORF067661	ABM	1.0 ug DNA	EUR 506

Gnat2 ORF Vector (Mouse) (pORF)
ORF046317	ABM	1.0 ug DNA	EUR 506

GNAT2 sgRNA CRISPR Lentivector set (Human)
K0875601	ABM	3 x 1.0 ug	EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Mouse)
K3838901	ABM	3 x 1.0 ug	EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Rat)
K6721101	ABM	3 x 1.0 ug	EUR 339

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0875602	ABM	1.0 ug DNA	EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0875603	ABM	1.0 ug DNA	EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0875604	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3838902	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3838903	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3838904	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6721102	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6721103	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6721104	ABM	1.0 ug DNA	EUR 154

GNAT2 Protein Vector (Mouse) (pPB-C-His)
PV185266	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Mouse) (pPB-N-His)
PV185267	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-HA)
PV185268	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-His)
PV185269	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPB-C-His)
PV270642	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPB-N-His)
PV270643	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-HA)
PV270644	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-His)
PV270645	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Human) (pPB-C-His)
PV017989	ABM	500 ng	EUR 329

GNAT2 Protein Vector (Human) (pPB-N-His)
PV017990	ABM	500 ng	EUR 329

GNAT3 siRNA
20-abx902217	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAT3 siRNA
20-abx918166	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAT3 siRNA
20-abx918167	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAT3 Antibody
37600-100ul	SAB	100ul	EUR 252

GNAT3 Antibody
1-CSB-PA587164	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAT3. Recognizes GNAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GNAT3 Antibody
1-CSB-PA693151	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAT3. Recognizes GNAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GNAT3 Conjugated Antibody
C37600	SAB	100ul	EUR 397

GNAT3 Rabbit pAb
A15982-100ul	Abclonal	100 ul	EUR 308

GNAT3 Rabbit pAb
A15982-200ul	Abclonal	200 ul	EUR 459

GNAT3 Rabbit pAb
A15982-20ul	Abclonal	20 ul	EUR 183

GNAT3 Rabbit pAb
A15982-50ul	Abclonal	50 ul	EUR 223

Anti-GNAT3 antibody
STJ71398	St John's Laboratory	100 µg	EUR 359

Anti-GNAT3 antibody
STJ118441	St John's Laboratory	100 µl	EUR 277

Rat GNAT3 shRNA Plasmid
20-abx988170	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAT3 shRNA Plasmid
20-abx982610	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAT3 ELISA KIT
ELI-27252h	Lifescience Market	96 Tests	EUR 824

Mouse Gnat3 ELISA KIT
ELI-47243m	Lifescience Market	96 Tests	EUR 865

Bovine GNAT3 ELISA KIT
ELI-48773b	Lifescience Market	96 Tests	EUR 928

Human GNAT3 shRNA Plasmid
20-abx967484	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNAT3 Recombinant Protein (Human)
RP060753	ABM	100 ug	Ask for price

GNAT3 Recombinant Protein (Rat)
RP202982	ABM	100 ug	Ask for price

GNAT3 Recombinant Protein (Mouse)
RP138950	ABM	100 ug	Ask for price

Polyclonal GNAT3 / Gustducin Antibody (Internal)
APR12054G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAT3 / Gustducin (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal GNAT3 Antibody (internal region)
APR12055G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAT3 (internal region). This antibody is tested and proven to work in the following applications:

Gnat3 ORF Vector (Rat) (pORF)
ORF067662	ABM	1.0 ug DNA	EUR 506

Gnat3 ORF Vector (Mouse) (pORF)
ORF046318	ABM	1.0 ug DNA	EUR 506

GNAT3 ORF Vector (Human) (pORF)
ORF020252	ABM	1.0 ug DNA	EUR 405

GNAT3 sgRNA CRISPR Lentivector set (Human)
K0875701	ABM	3 x 1.0 ug	EUR 339

Gnat3 sgRNA CRISPR Lentivector set (Mouse)
K3899001	ABM	3 x 1.0 ug	EUR 339

Gnat3 sgRNA CRISPR Lentivector set (Rat)
K7362501	ABM	3 x 1.0 ug	EUR 339

GNAT3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0875702	ABM	1.0 ug DNA	EUR 154

GNAT3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0875703	ABM	1.0 ug DNA	EUR 154

GNAT3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0875704	ABM	1.0 ug DNA	EUR 154

Gnat3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3899002	ABM	1.0 ug DNA	EUR 154

Gnat3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3899003	ABM	1.0 ug DNA	EUR 154

Gnat3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3899004	ABM	1.0 ug DNA	EUR 154

Gnat3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7362502	ABM	1.0 ug DNA	EUR 154

Gnat3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7362503	ABM	1.0 ug DNA	EUR 154

Gnat3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7362504	ABM	1.0 ug DNA	EUR 154

GNAT3 Protein Vector (Human) (pPB-C-His)
PV081005	ABM	500 ng	EUR 552

GNAT3 Protein Vector (Human) (pPB-N-His)
PV081006	ABM	500 ng	EUR 552

GNAT3 Protein Vector (Human) (pPM-C-HA)
PV081007	ABM	500 ng	EUR 552

GNAT3 Protein Vector (Human) (pPM-C-His)
PV081008	ABM	500 ng	EUR 552

GNAT3 Protein Vector (Mouse) (pPB-C-His)
PV185270	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Mouse) (pPB-N-His)
PV185271	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Mouse) (pPM-C-HA)
PV185272	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Mouse) (pPM-C-His)
PV185273	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Rat) (pPB-C-His)
PV270646	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Rat) (pPB-N-His)
PV270647	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Rat) (pPM-C-HA)
PV270648	ABM	500 ng	EUR 603

GNAT3 Protein Vector (Rat) (pPM-C-His)
PV270649	ABM	500 ng	EUR 603

Gnat3 3'UTR Luciferase Stable Cell Line
TU205214	ABM	1.0 ml	Ask for price

Gnat3 3'UTR GFP Stable Cell Line
TU158855	ABM	1.0 ml	Ask for price

GNAT3 3'UTR Luciferase Stable Cell Line
TU008981	ABM	1.0 ml	EUR 2333

Gnat3 3'UTR Luciferase Stable Cell Line
TU108855	ABM	1.0 ml	Ask for price

GNAT3 3'UTR GFP Stable Cell Line
TU058981	ABM	1.0 ml	EUR 2333

Gnat3 3'UTR GFP Stable Cell Line
TU255214	ABM	1.0 ml	Ask for price

G Protein Subunit Alpha Transducin 3 (GNAT3) Antibody
20-abx213861	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

G Protein Subunit Alpha Transducin 3 (GNAT3) Antibody
20-abx241967	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

GNAT3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV676201	ABM	1.0 ug DNA	EUR 682

GNG12 siRNA
20-abx918190	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG12 siRNA
20-abx918191	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG12 antibody
70R-51389	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal GNG12 antibody

GNG12 Antibody
46003-100ul	SAB	100ul	EUR 252

GNG12 Antibody
46003-50ul	SAB	50ul	EUR 187

GNG12 Antibody
DF9556	Affbiotech	200ul	EUR 304
Description: GNG12 Antibody detects endogenous levels of total GNG12.

GNG12 Antibody
1-CSB-PA883362OA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNG12 Conjugated Antibody
C46003	SAB	100ul	EUR 397

GNG12 Blocking Peptide
20-abx064264	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Human GNG12 Antibody
32775-05111	AssayPro	150 ug	EUR 261

GNG12 cloning plasmid
CSB-CL883362HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 219 Sequence: atgtccagcaaaacagcaagcaccaacaatatagcccaggcaaggagaactgtgcagcagttaagattagaagcctccattgaaggaataaaggtttcgaaggcatcagcggacctcatgtcctactgtgaggaacatgccaggagtgaccctttgctgataggaataccaacttc Show more
Description: A cloning plasmid for the GNG12 gene.

GNG12 Blocking Peptide
DF9556-BP	Affbiotech	1mg	EUR 195

Mouse Gng12 ELISA KIT
ELI-27207m	Lifescience Market	96 Tests	EUR 865

Human GNG12 ELISA KIT
ELI-47373h	Lifescience Market	96 Tests	EUR 824

Bovine GNG12 ELISA KIT
ELI-32426b	Lifescience Market	96 Tests	EUR 928

GNG12 protein (His tag)
80R-4135	Fitzgerald	100 ug	EUR 327
Description: Recombinant Human GNG12 protein (His tag)

Mouse GNG12 shRNA Plasmid
20-abx970595	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNG12 shRNA Plasmid
20-abx961028	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNG12 Antibody, HRP conjugated
1-CSB-PA883362OB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG12 Antibody, FITC conjugated
1-CSB-PA883362OC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG12 Antibody, Biotin conjugated
1-CSB-PA883362OD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG12 Recombinant Protein (Human)
RP013540	ABM	100 ug	Ask for price

GNG12 Recombinant Protein (Mouse)
RP139001	ABM	100 ug	Ask for price

GNG12 Recombinant Protein (Mouse)
RP139004	ABM	100 ug	Ask for price

GNG12 Recombinant Protein (Mouse)
RP139007	ABM	100 ug	Ask for price

GNG12 Recombinant Protein (Mouse)
RP139010	ABM	100 ug	Ask for price

GNG12 Recombinant Protein (Mouse)
RP139013	ABM	100 ug	Ask for price

GNG12 Recombinant Protein (Mouse)
RP139016	ABM	100 ug	Ask for price

Polyclonal GNG12 Antibody (C-Term)
APR04951G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG12 (C-Term). This antibody is tested and proven to work in the following applications:

Human GNG12 Antibody (Biotin Conjugate)
32775-05121	AssayPro	150 ug	EUR 369

Human GNG12 Antibody (APC Conjguate)
32775-05161	AssayPro	150 ug	EUR 428

GNG12 ORF Vector (Human) (pORF)
ORF004514	ABM	1.0 ug DNA	EUR 95

Gng12 ORF Vector (Mouse) (pORF)
ORF046335	ABM	1.0 ug DNA	EUR 506

Gng12 ORF Vector (Mouse) (pORF)
ORF046336	ABM	1.0 ug DNA	EUR 506

Gng12 ORF Vector (Mouse) (pORF)
ORF046337	ABM	1.0 ug DNA	EUR 506

Gng12 ORF Vector (Mouse) (pORF)
ORF046338	ABM	1.0 ug DNA	EUR 506

Gng12 ORF Vector (Mouse) (pORF)
ORF046339	ABM	1.0 ug DNA	EUR 506

Gng12 ORF Vector (Mouse) (pORF)
ORF046340	ABM	1.0 ug DNA	EUR 506

GNG12 sgRNA CRISPR Lentivector set (Human)
K0877901	ABM	3 x 1.0 ug	EUR 339

Human GNG12 AssayLite Antibody (FITC Conjugate)
32775-05141	AssayPro	150 ug	EUR 428

Human GNG12 AssayLite Antibody (RPE Conjugate)
32775-05151	AssayPro	150 ug	EUR 428

Human GNG12 AssayLite Antibody (PerCP Conjugate)
32775-05171	AssayPro	150 ug	EUR 471

Gng12 sgRNA CRISPR Lentivector set (Mouse)
K4904001	ABM	3 x 1.0 ug	EUR 339

GNG12 sgRNA CRISPR Lentivector (Human) (Target 1)
K0877902	ABM	1.0 ug DNA	EUR 154

GNG12 sgRNA CRISPR Lentivector (Human) (Target 2)
K0877903	ABM	1.0 ug DNA	EUR 154

GNG12 sgRNA CRISPR Lentivector (Human) (Target 3)
K0877904	ABM	1.0 ug DNA	EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4904002	ABM	1.0 ug DNA	EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4904003	ABM	1.0 ug DNA	EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4904004	ABM	1.0 ug DNA	EUR 154

GNG12 Protein Vector (Mouse) (pPB-C-His)
PV185338	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)
PV185339	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)
PV185340	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-His)
PV185341	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPB-C-His)
PV185342	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)
PV185343	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)
PV185344	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-His)
PV185345	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPB-C-His)
PV185346	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)
PV185347	ABM	500 ng	EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)
PV185348	ABM	500 ng	EUR 603

GNGT2 siRNA
20-abx918209	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNGT2 antibody
70R-3637	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GNGT2 antibody raised against the middle region of Gngt2

GNGT2 Antibody
47622-100ul	SAB	100ul	EUR 252

GNGT2 Antibody
1-CSB-PA009622LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

GNGT2 Conjugated Antibody
C47622	SAB	100ul	EUR 397

GNGT2 cloning plasmid
CSB-CL009622HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 210 Sequence: atggcccaggatctcagcgagaaggacctgttgaagatggaggtggagcagctgaagaaagaagtgaaaaacacaagaattccgatttccaaagcgggaaaggaaatcaaggagtacgtggaggcccaagcaggaaacgatccttttctcaaaggcatccctgaggacaagaatcc Show more
Description: A cloning plasmid for the GNGT2 gene.

GNGT2 Antibody (HRP)
20-abx304027	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNGT2 Antibody (FITC)
20-abx304028	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNGT2 Antibody (Biotin)
20-abx304029	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNGT2 Polyclonal Antibody
A59270	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNGT2 Rabbit pAb
A13992-100ul	Abclonal	100 ul	EUR 308

GNGT2 Rabbit pAb
A13992-200ul	Abclonal	200 ul	EUR 459

GNGT2 Rabbit pAb
A13992-20ul	Abclonal	20 ul	EUR 183

GNGT2 Rabbit pAb
A13992-50ul	Abclonal	50 ul	EUR 223

GNGT2 Rabbit pAb
A9818-100ul	Abclonal	100 ul	EUR 308

GNGT2 Rabbit pAb
A9818-200ul	Abclonal	200 ul	EUR 459

GNGT2 Rabbit pAb
A9818-20ul	Abclonal	20 ul	EUR 183

GNGT2 Rabbit pAb
A9818-50ul	Abclonal	50 ul	EUR 223

GNGT2 Blocking Peptide
33R-4362	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNGT2 antibody, catalog no. 70R-3637

pCMV-SPORT6-GNGT2
PVT12817	Lifescience Market	2 ug	EUR 391

Anti-GNGT2 antibody
STJ111860	St John's Laboratory	100 µl	EUR 277
Description: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene.

Anti-GNGT2 antibody
STJ115927	St John's Laboratory	100 µl	EUR 277
Description: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene.

Bovine GNGT2 ELISA KIT
ELI-21492b	Lifescience Market	96 Tests	EUR 928

Mouse Gngt2 ELISA KIT
ELI-27210m	Lifescience Market	96 Tests	EUR 865

Canine GNGT2 ELISA KIT
ELI-47376d	Lifescience Market	96 Tests	EUR 928

Human GNGT2 ELISA KIT
ELI-32428h	Lifescience Market	96 Tests	EUR 824

Mouse GNGT2 shRNA Plasmid
20-abx970603	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNGT2 shRNA Plasmid
20-abx951864	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNGT2 Antibody, HRP conjugated
1-CSB-PA009622LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNGT2 Antibody, FITC conjugated
1-CSB-PA009622LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNGT2 Antibody, Biotin conjugated
1-CSB-PA009622LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNGT2 Recombinant Protein (Human)
RP013561	ABM	100 ug	Ask for price

GNGT2 Recombinant Protein (Rat)
RP203039	ABM	100 ug	Ask for price

GNGT2 Recombinant Protein (Mouse)
RP139049	ABM	100 ug	Ask for price

GNGT2 Recombinant Protein (Mouse)
RP139052	ABM	100 ug	Ask for price

GNGT2 Polyclonal Antibody, Biotin Conjugated
A59271	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNGT2 Polyclonal Antibody, FITC Conjugated
A59272	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNGT2 Polyclonal Antibody, HRP Conjugated
A59273	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNGT2 ORF Vector (Human) (pORF)
ORF004521	ABM	1.0 ug DNA	EUR 95

Gngt2 ORF Vector (Rat) (pORF)
ORF067681	ABM	1.0 ug DNA	EUR 506

Gngt2 ORF Vector (Mouse) (pORF)
ORF046351	ABM	1.0 ug DNA	EUR 506

Gngt2 ORF Vector (Mouse) (pORF)
ORF046352	ABM	1.0 ug DNA	EUR 506

GNGT2 sgRNA CRISPR Lentivector set (Human)
K0878201	ABM	3 x 1.0 ug	EUR 339

Gngt2 sgRNA CRISPR Lentivector set (Mouse)
K4579001	ABM	3 x 1.0 ug	EUR 339

Gngt2 sgRNA CRISPR Lentivector set (Rat)
K6576801	ABM	3 x 1.0 ug	EUR 339

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0878202	ABM	1.0 ug DNA	EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0878203	ABM	1.0 ug DNA	EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0878204	ABM	1.0 ug DNA	EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4579002	ABM	1.0 ug DNA	EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4579003	ABM	1.0 ug DNA	EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4579004	ABM	1.0 ug DNA	EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6576802	ABM	1.0 ug DNA	EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6576803	ABM	1.0 ug DNA	EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6576804	ABM	1.0 ug DNA	EUR 154

GNGT2 Protein Vector (Mouse) (pPB-C-His)
PV185402	ABM	500 ng	EUR 603

GNGT2 Protein Vector (Mouse) (pPB-N-His)
PV185403	ABM	500 ng	EUR 603

GNGT2 Protein Vector (Mouse) (pPM-C-HA)
PV185404	ABM	500 ng	EUR 603

GNGT2 Protein Vector (Mouse) (pPM-C-His)
PV185405	ABM	500 ng	EUR 603

GNGT2 Protein Vector (Mouse) (pPB-C-His)
PV185406	ABM	500 ng	EUR 603

GNGT2 Protein Vector (Mouse) (pPB-N-His)
PV185407	ABM	500 ng	EUR 603