USP4 siRNA
20-abx905987	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP4 siRNA
20-abx939247	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP4 siRNA
20-abx939248	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP4 antibody
20R-UR008	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal USP4 antibody

USP4 antibody
20R-UR009	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal USP4 antibody

USP4 Antibody
6131-50	Biovision		EUR 207

USP4 Antibody
1-CSB-PA614393LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:50-1:200

Polyclonal USP4 Antibody
APC00002G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human USP4 . This antibody is tested and proven to work in the following applications:

USP4 cloning plasmid
CSB-CL614393HU-10ug	Cusabio	10ug	EUR 919
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2892 Sequence: ATGGCGGAAGGTGGAGGCTGCCGTGAGCGACCGGATGCGGAGACTCAGAAGTCCGAGCTTGGACCCTTAATGAGGACCACACTCCAACGCGGGGCGCAGTGGTATCTTATTGACAGCCGGTGGTTCAAGCAGTGGAAGAAGTATGTGGGCTTTGACAGCTGGGACATGTACAATG Show more
Description: A cloning plasmid for the USP4 gene.

USP4 Polyclonal Antibody
ABP-PAB-31070	Allele Biotech	50 ug	Ask for price
Product line: Proteases Brand:

USP4 Polyclonal Antibody
ABP-PAB-31071	Allele Biotech	50 ug	Ask for price
Product line: Proteases Brand:

USP4 Rabbit pAb
A12242-100ul	Abclonal	100 ul	EUR 308

USP4 Rabbit pAb
A12242-200ul	Abclonal	200 ul	EUR 459

USP4 Rabbit pAb
A12242-20ul	Abclonal	20 ul	EUR 183

USP4 Rabbit pAb
A12242-50ul	Abclonal	50 ul	EUR 223

USP4 Polyclonal Antibody
27659-100ul	SAB	100ul	EUR 252

USP4 Polyclonal Antibody
27659-50ul	SAB	50ul	EUR 187

Anti-USP4 antibody
STJ11100881	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene.

Anti-USP4 antibody
STJ114133	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene.

Anti-USP4 (5E12)
YF-MA16029	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to USP4

Polyclonal USP4 Antibody (Internal)
APR02105G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP4 (Internal). This antibody is tested and proven to work in the following applications:

USP4 Polyclonal Conjugated Antibody
C27659	SAB	100ul	EUR 397

Rat USP4 shRNA Plasmid
20-abx988470	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human USP4 shRNA Plasmid
20-abx955045	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse USP4 shRNA Plasmid
20-abx973320	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

USP4 Antibody, HRP conjugated
1-CSB-PA614393LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USP4 Antibody, FITC conjugated
1-CSB-PA614393LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USP4 Antibody, Biotin conjugated
1-CSB-PA614393LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pEnCMV-USP4-AA-3
PVT18891	Lifescience Market	2 ug	EUR 258

Anti-USP4 / UNP antibody
STJ70372	St John's Laboratory	100 µg	EUR 359

Polyclonal USP4 Antibody (N-term)
APR03989G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP4 (N-term). This antibody is tested and proven to work in the following applications:

[KO Validated] USP4 Rabbit pAb
A20005-100ul	Abclonal	100 ul	EUR 410

[KO Validated] USP4 Rabbit pAb
A20005-200ul	Abclonal	200 ul	EUR 571

[KO Validated] USP4 Rabbit pAb
A20005-20ul	Abclonal	20 ul	EUR 221

[KO Validated] USP4 Rabbit pAb
A20005-50ul	Abclonal	50 ul	EUR 287

Usp4 ORF Vector (Rat) (pORF)
ORF078702	ABM	1.0 ug DNA	EUR 506

Usp4 ORF Vector (Rat) (pORF)
ORF078703	ABM	1.0 ug DNA	EUR 506

USP4 ORF Vector (Human) (pORF)
ORF014906	ABM	1.0 ug DNA	EUR 354

Usp4 ORF Vector (Mouse) (pORF)
ORF061148	ABM	1.0 ug DNA	EUR 506

pECMV-Usp4-m-FLAG Plasmid
PVT15625	Lifescience Market	2 ug	EUR 325

Polyclonal USP4 / UNP Antibody (N-Term)
APG00412G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP4 / UNP (N-Term). This antibody is tested and proven to work in the following applications:

Ubiquitin Specific Peptidase 4 (USP4) Antibody
20-abx126770	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx028210-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx028210-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 4 (USP4) Antibody
20-abx338541	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx411851-50ug	Abbexa	50 ug	EUR 704
Shipped within 1 week.

Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx430309-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

USP4 sgRNA CRISPR Lentivector set (Human)
K2596201	ABM	3 x 1.0 ug	EUR 339

Usp4 sgRNA CRISPR Lentivector set (Mouse)
K4870901	ABM	3 x 1.0 ug	EUR 339

Usp4 sgRNA CRISPR Lentivector set (Rat)
K6690001	ABM	3 x 1.0 ug	EUR 339

Ubiquitin Specific Peptidase 4 (USP4) Antibody (HRP)
20-abx338188	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 4 (USP4) Antibody (FITC)
20-abx338189	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 4 (USP4) Antibody (Biotin)
20-abx338190	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2596202	ABM	1.0 ug DNA	EUR 154

USP4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2596203	ABM	1.0 ug DNA	EUR 154

USP4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2596204	ABM	1.0 ug DNA	EUR 154

Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4870902	ABM	1.0 ug DNA	EUR 154

Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4870903	ABM	1.0 ug DNA	EUR 154

Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4870904	ABM	1.0 ug DNA	EUR 154

Usp4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6690002	ABM	1.0 ug DNA	EUR 154

Usp4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6690003	ABM	1.0 ug DNA	EUR 154

Usp4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6690004	ABM	1.0 ug DNA	EUR 154

USP4 Protein Vector (Human) (pPB-C-His)
PV059621	ABM	500 ng	EUR 481

USP4 Protein Vector (Human) (pPB-N-His)
PV059622	ABM	500 ng	EUR 481

USP4 Protein Vector (Human) (pPM-C-HA)
PV059623	ABM	500 ng	EUR 481

USP4 Protein Vector (Human) (pPM-C-His)
PV059624	ABM	500 ng	EUR 481

USP4 Protein Vector (Rat) (pPB-C-His)
PV314806	ABM	500 ng	EUR 1166

USP4 Protein Vector (Rat) (pPB-N-His)
PV314807	ABM	500 ng	EUR 1166

USP4 Protein Vector (Rat) (pPM-C-HA)
PV314808	ABM	500 ng	EUR 1166

USP4 Protein Vector (Rat) (pPM-C-His)
PV314809	ABM	500 ng	EUR 1166

USP4 Protein Vector (Rat) (pPB-C-His)
PV314810	ABM	500 ng	EUR 1191

USP4 Protein Vector (Rat) (pPB-N-His)
PV314811	ABM	500 ng	EUR 1191

USP4 Protein Vector (Rat) (pPM-C-HA)
PV314812	ABM	500 ng	EUR 1191

USP4 Protein Vector (Rat) (pPM-C-His)
PV314813	ABM	500 ng	EUR 1191

USP4 Protein Vector (Mouse) (pPB-C-His)
PV244590	ABM	500 ng	EUR 1065