USP4

USP4 siRNA
20-abx905987
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP4 siRNA
20-abx939247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP4 siRNA
20-abx939248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP4 antibody
20R-UR008 50 ug
EUR 656
Description: Rabbit polyclonal USP4 antibody
USP4 antibody
20R-UR009 50 ug
EUR 656
Description: Rabbit polyclonal USP4 antibody
USP4 Antibody
6131-50
EUR 207
USP4 Antibody
1-CSB-PA614393LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:50-1:200
Polyclonal USP4 Antibody
APC00002G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human USP4 . This antibody is tested and proven to work in the following applications:
USP4 cloning plasmid
CSB-CL614393HU-10ug 10ug
EUR 919
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2892
  • Sequence: ATGGCGGAAGGTGGAGGCTGCCGTGAGCGACCGGATGCGGAGACTCAGAAGTCCGAGCTTGGACCCTTAATGAGGACCACACTCCAACGCGGGGCGCAGTGGTATCTTATTGACAGCCGGTGGTTCAAGCAGTGGAAGAAGTATGTGGGCTTTGACAGCTGGGACATGTACAATG
  • Show more
Description: A cloning plasmid for the USP4 gene.
USP4 Polyclonal Antibody
ABP-PAB-31070 50 ug Ask for price
    • Product line: Proteases
    • Brand:
USP4 Polyclonal Antibody
ABP-PAB-31071 50 ug Ask for price
    • Product line: Proteases
    • Brand:
USP4 Rabbit pAb
A12242-100ul 100 ul
EUR 308
USP4 Rabbit pAb
A12242-200ul 200 ul
EUR 459
USP4 Rabbit pAb
A12242-20ul 20 ul
EUR 183
USP4 Rabbit pAb
A12242-50ul 50 ul
EUR 223
USP4 Polyclonal Antibody
27659-100ul 100ul
EUR 252
USP4 Polyclonal Antibody
27659-50ul 50ul
EUR 187
Anti-USP4 antibody
STJ11100881 100 µl
EUR 413
Description: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene.
Anti-USP4 antibody
STJ114133 100 µl
EUR 277
Description: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene.
Anti-USP4 (5E12)
YF-MA16029 100 ug
EUR 363
Description: Mouse monoclonal to USP4
Polyclonal USP4 Antibody (Internal)
APR02105G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP4 (Internal). This antibody is tested and proven to work in the following applications:
USP4 Polyclonal Conjugated Antibody
C27659 100ul
EUR 397
Rat USP4 shRNA Plasmid
20-abx988470
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP4 shRNA Plasmid
20-abx955045
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse USP4 shRNA Plasmid
20-abx973320
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP4 Antibody, HRP conjugated
1-CSB-PA614393LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP4 Antibody, FITC conjugated
1-CSB-PA614393LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP4 Antibody, Biotin conjugated
1-CSB-PA614393LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
pEnCMV-USP4-AA-3
PVT18891 2 ug
EUR 258
Anti-USP4 / UNP antibody
STJ70372 100 µg
EUR 359
Polyclonal USP4 Antibody (N-term)
APR03989G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP4 (N-term). This antibody is tested and proven to work in the following applications:
[KO Validated] USP4 Rabbit pAb
A20005-100ul 100 ul
EUR 410
[KO Validated] USP4 Rabbit pAb
A20005-200ul 200 ul
EUR 571
[KO Validated] USP4 Rabbit pAb
A20005-20ul 20 ul
EUR 221
[KO Validated] USP4 Rabbit pAb
A20005-50ul 50 ul
EUR 287
Usp4 ORF Vector (Rat) (pORF)
ORF078702 1.0 ug DNA
EUR 506
Usp4 ORF Vector (Rat) (pORF)
ORF078703 1.0 ug DNA
EUR 506
USP4 ORF Vector (Human) (pORF)
ORF014906 1.0 ug DNA
EUR 354
Usp4 ORF Vector (Mouse) (pORF)
ORF061148 1.0 ug DNA
EUR 506
pECMV-Usp4-m-FLAG Plasmid
PVT15625 2 ug
EUR 325
Polyclonal USP4 / UNP Antibody (N-Term)
APG00412G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP4 / UNP (N-Term). This antibody is tested and proven to work in the following applications:
Ubiquitin Specific Peptidase 4 (USP4) Antibody
20-abx126770
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx028210-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx028210-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
20-abx338541
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx411851-50ug 50 ug
EUR 704
  • Shipped within 1 week.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx430309-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
USP4 sgRNA CRISPR Lentivector set (Human)
K2596201 3 x 1.0 ug
EUR 339
Usp4 sgRNA CRISPR Lentivector set (Mouse)
K4870901 3 x 1.0 ug
EUR 339
Usp4 sgRNA CRISPR Lentivector set (Rat)
K6690001 3 x 1.0 ug
EUR 339
Ubiquitin Specific Peptidase 4 (USP4) Antibody (HRP)
20-abx338188
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody (FITC)
20-abx338189
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody (Biotin)
20-abx338190
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2596202 1.0 ug DNA
EUR 154
USP4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2596203 1.0 ug DNA
EUR 154
USP4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2596204 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4870902 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4870903 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4870904 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6690002 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6690003 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6690004 1.0 ug DNA
EUR 154
USP4 Protein Vector (Human) (pPB-C-His)
PV059621 500 ng
EUR 481
USP4 Protein Vector (Human) (pPB-N-His)
PV059622 500 ng
EUR 481
USP4 Protein Vector (Human) (pPM-C-HA)
PV059623 500 ng
EUR 481
USP4 Protein Vector (Human) (pPM-C-His)
PV059624 500 ng
EUR 481
USP4 Protein Vector (Rat) (pPB-C-His)
PV314806 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPB-N-His)
PV314807 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPM-C-HA)
PV314808 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPM-C-His)
PV314809 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPB-C-His)
PV314810 500 ng
EUR 1191
USP4 Protein Vector (Rat) (pPB-N-His)
PV314811 500 ng
EUR 1191
USP4 Protein Vector (Rat) (pPM-C-HA)
PV314812 500 ng
EUR 1191
USP4 Protein Vector (Rat) (pPM-C-His)
PV314813 500 ng
EUR 1191
USP4 Protein Vector (Mouse) (pPB-C-His)
PV244590 500 ng
EUR 1065