Human TNMD(Tenomodulin) ELISA Kit


Human TNMD(Tenomodulin) ELISA Kit 

Order Now:

Human Tenomodulin (TNMD) ELISA Kit
EUR 673
  • Should the Human Tenomodulin (TNMD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tenomodulin (TNMD) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tenomodulin (TNMD) ELISA Kit
RDR-TNMD-Hu-48Tests 48 Tests
EUR 544
Human Tenomodulin (TNMD) ELISA Kit
RDR-TNMD-Hu-96Tests 96 Tests
EUR 756
Human Tenomodulin (TNMD) ELISA Kit
RD-TNMD-Hu-48Tests 48 Tests
EUR 521
Human Tenomodulin (TNMD) ELISA Kit
RD-TNMD-Hu-96Tests 96 Tests
EUR 723
Human Tenomodulin (TNMD) ELISA Kit
abx572549-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human TNMD/ Tenomodulin ELISA Kit
E2556Hu 1 Kit
EUR 571
Human TNMD(Tenomodulin) ELISA Kit
EH1104 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9H2S6
  • Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Tenomodulin, TNMD ELISA KIT
ELI-03188h 96 Tests
EUR 824
Human Tenomodulin (TNMD) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Tenomodulin (TNMD) ELISA Kit
abx250350-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Tenomodulin(TNMD) ELISA kit
CSB-EL024007HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Tenomodulin(TNMD) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.
Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.
Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.
Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.
Human Tenomodulin (TNMD) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tenomodulin elisa. Alternative names of the recognized antigen: TEM
  • BRICD4
  • CHM1L
  • Myodulin
  • Tendin
  • Chondromodulin-1-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tenomodulin (TNMD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Tenomodulin(TNMD)ELISA Kit
QY-E02852 96T
EUR 361
Mouse Tenomodulin (TNMD) ELISA Kit
abx514514-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Tnmd/ Tenomodulin ELISA Kit
E0991Ra 1 Kit
EUR 571
Mouse Tenomodulin, Tnmd ELISA KIT
ELI-03189m 96 Tests
EUR 865
Rat Tnmd(Tenomodulin) ELISA Kit
ER0403 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9ESC2
  • Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml
Rat Tenomodulin (TNMD) ELISA Kit
abx256381-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Tenomodulin(TNMD) ELISA kit
CSB-EL024007MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Tenomodulin(TNMD) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Tenomodulin (TNMD) Antibody
abx026953-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tenomodulin (TNMD) Antibody
abx026953-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tenomodulin (TNMD) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tenomodulin (TNMD) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tenomodulin (TNMD) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Mouse Tenomodulin (Tnmd)
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in Yeast
Mouse Tenomodulin (Tnmd)
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in E.coli
ELISA kit for Human TNMD (Tenomodulin)
ELK3581 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tenomodulin (TNMD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tenomodulin (TN
  • Show more
Description: A sandwich ELISA kit for detection of Tenomodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Tenomodulin (TNMD)
KTE60192-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Tenomodulin (TNMD)
KTE60192-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Tenomodulin (TNMD)
KTE60192-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Tenomodulin (TNMD) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Tenomodulin (TNMD) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Tnmd ELISA Kit| Rat Tenomodulin ELISA Kit
EF017252 96 Tests
EUR 689
Tenomodulin (TNMD) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tenomodulin (TNMD) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tenomodulin (TNMD) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tnmd/ Rat Tnmd ELISA Kit
ELI-03190r 96 Tests
EUR 886
ELA-E0989h 96 Tests
EUR 824
EF001697 96 Tests
EUR 689
ELISA kit for Human Tenomodulin
EK2501 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tenomodulin in samples from serum, plasma, tissue homogenates and other biological fluids.
TNMD ELISA Kit (Human) (OKCD08258)
OKCD08258 96 Wells
EUR 975
Description: Description of target: TNMD is a single-pass type II membrane proteinPotential. It belongs to the chondromodulin-1 family and contains 1 BRICHOS domain. TNMD may be an angiogenesis inhibitor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL
Tenomodulin antibody
70R-6905 50 ug
EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the N terminal of TNMD
Tenomodulin antibody
70R-6317 50 ug
EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the middle region of TNMD
TNMD ELISA Kit (Rat) (OKEH04398)
OKEH04398 96 Wells
EUR 662
Description: Description of target: transmembrane protein; may be an angiogenesis inhibitor; may play a regulatory role in eye and skeletal muscle development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.089 ng/mL
TNMD ELISA Kit (Mouse) (OKCA02464)
OKCA02464 96 Wells
EUR 846
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 2.34 pg/mL
TNMD ELISA Kit (Mouse) (OKEH05757)
OKEH05757 96 Wells
EUR 662
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNMD Antibody
43641-100ul 100ul
EUR 252
TNMD Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
Tenomodulin Blocking Peptide
33R-4477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6905
Tenomodulin Blocking Peptide
33R-7661 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6317
Human TNMD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNMD Recombinant Protein (Human)
RP032482 100 ug Ask for price
TNMD Conjugated Antibody
C43641 100ul
EUR 397
TNMD cloning plasmid
CSB-CL024007HU-10ug 10ug
EUR 285
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaa
  • Show more
Description: A cloning plasmid for the TNMD gene.
TNMD Rabbit pAb
A17753-100ul 100 ul
EUR 308
TNMD Rabbit pAb
A17753-200ul 200 ul
EUR 459
TNMD Rabbit pAb
A17753-20ul 20 ul
EUR 183
TNMD Rabbit pAb
A17753-50ul 50 ul
EUR 223
Recombinant mouse Tnmd
P1421 100ug Ask for price
  • Uniprot ID: Q9EP64
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Tnmd
Anti-TNMD antibody
STJ119792 100 µl
EUR 277
Description: This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009]
TNMD ORF Vector (Human) (pORF)
ORF010828 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Polyclonal TNMD Antibody (Center)
APR03728G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNMD (Center). This antibody is tested and proven to work in the following applications:
Mouse TNMD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TNMD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNMD Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TNMD Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TNMD Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TNMD Recombinant Protein (Rat)
RP234134 100 ug Ask for price
TNMD Recombinant Protein (Mouse)
RP180350 100 ug Ask for price
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
TNMD sgRNA CRISPR Lentivector set (Human)
K2419001 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Tnmd ORF Vector (Mouse) (pORF)
ORF060118 1.0 ug DNA
EUR 506
Tnmd ORF Vector (Rat) (pORF)
ORF078046 1.0 ug DNA
EUR 506
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
TNMD sgRNA CRISPR Lentivector (Human) (Target 1)
K2419002 1.0 ug DNA
EUR 154
TNMD sgRNA CRISPR Lentivector (Human) (Target 2)
K2419003 1.0 ug DNA
EUR 154
TNMD sgRNA CRISPR Lentivector (Human) (Target 3)
K2419004 1.0 ug DNA
EUR 154
TNMD Protein Vector (Human) (pPB-C-His)
PV043309 500 ng
EUR 329
TNMD Protein Vector (Human) (pPB-N-His)
PV043310 500 ng
EUR 329
TNMD Protein Vector (Human) (pPM-C-HA)
PV043311 500 ng
EUR 329
TNMD Protein Vector (Human) (pPM-C-His)
PV043312 500 ng
EUR 329
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Tnmd sgRNA CRISPR Lentivector set (Mouse)
K3684001 3 x 1.0 ug
EUR 339
Tnmd sgRNA CRISPR Lentivector set (Rat)
K6960501 3 x 1.0 ug
EUR 339
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3684002 1.0 ug DNA
EUR 154
Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3684003 1.0 ug DNA
EUR 154
Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3684004 1.0 ug DNA
EUR 154
Tnmd sgRNA CRISPR Lentivector (Rat) (Target 1)
K6960502 1.0 ug DNA
EUR 154
Tnmd sgRNA CRISPR Lentivector (Rat) (Target 2)
K6960503 1.0 ug DNA
EUR 154
Tnmd sgRNA CRISPR Lentivector (Rat) (Target 3)
K6960504 1.0 ug DNA
EUR 154
TNMD Protein Vector (Rat) (pPB-C-His)
PV312182 500 ng
EUR 603
TNMD Protein Vector (Rat) (pPB-N-His)
PV312183 500 ng
EUR 603
TNMD Protein Vector (Rat) (pPM-C-HA)
PV312184 500 ng
EUR 603
TNMD Protein Vector (Rat) (pPM-C-His)
PV312185 500 ng
EUR 603
TNMD Protein Vector (Mouse) (pPB-C-His)
PV240470 500 ng
EUR 603
TNMD Protein Vector (Mouse) (pPB-N-His)
PV240471 500 ng
EUR 603
TNMD Protein Vector (Mouse) (pPM-C-HA)
PV240472 500 ng
EUR 603
TNMD Protein Vector (Mouse) (pPM-C-His)
PV240473 500 ng
EUR 603
Tnmd 3'UTR GFP Stable Cell Line
TU170914 1.0 ml Ask for price
TNMD 3'UTR GFP Stable Cell Line
TU076052 1.0 ml
EUR 1394
Tnmd 3'UTR Luciferase Stable Cell Line
TU120914 1.0 ml Ask for price
TNMD 3'UTR Luciferase Stable Cell Line
TU026052 1.0 ml
EUR 1394
Tnmd 3'UTR Luciferase Stable Cell Line
TU222266 1.0 ml Ask for price
Tnmd 3'UTR GFP Stable Cell Line
TU272266 1.0 ml Ask for price
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2419005 3 x 1.0 ug
EUR 376
TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690205 1.0 ug DNA
EUR 514
TNMD Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690209 1.0 ug DNA
EUR 514
TNMD Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690210 1.0 ug DNA
EUR 514
TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2419006 1.0 ug DNA
EUR 167
TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2419007 1.0 ug DNA
EUR 167
TNMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2419008 1.0 ug DNA
EUR 167
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3684005 3 x 1.0 ug
EUR 376
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6960505 3 x 1.0 ug
EUR 376
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3684006 1.0 ug DNA
EUR 167
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3684007 1.0 ug DNA
EUR 167
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3684008 1.0 ug DNA
EUR 167
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6960506 1.0 ug DNA
EUR 167
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6960507 1.0 ug DNA
EUR 167
Tnmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6960508 1.0 ug DNA
EUR 167
TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV690206 1.0 ug DNA
EUR 514
TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV690207 1.0 ug DNA
EUR 572
TNMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV690208 1.0 ug DNA
EUR 572