SP100

SP100 Nuclear Antigen (SP100) Antibody
abx028278-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SP100 Nuclear Antigen (SP100) Antibody
20-abx004488
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sp100 Nuclear Antigen (Sp100) Antibody
20-abx102294
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sp100 Nuclear Antigen (SP100) Antibody
20-abx115747
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sp100 Nuclear Antigen (Sp100) Antibody
20-abx128509
  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sp100 Nuclear Antigen (Sp100) Antibody
20-abx130241
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SP100 Nuclear Antigen (SP100) Antibody
20-abx014668
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SP100 Nuclear Antigen (SP100) Antibody
abx238132-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Sp100 Nuclear Antigen (SP100) Antibody
abx331179-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Sp100 Nuclear Antigen (SP100) Antibody
20-abx324693
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Sp100 Nuclear Antigen (Sp100)
4-RPA326Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23497
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Sp100 Nuclear Antigen expressed in: E.coli
Recombinant Sp100 Nuclear Antigen (Sp100)
4-RPA326Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35892
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: 10.4
Description: Recombinant Mouse Sp100 Nuclear Antigen expressed in: E.coli
Recombinant Sp100 Nuclear Antigen (Sp100)
4-RPA326Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5XI80
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.6kDa
  • Isoelectric Point: 5.8
Description: Recombinant Rat Sp100 Nuclear Antigen expressed in: E.coli
Human Sp100 Nuclear Antigen (Sp100) Protein
20-abx166555
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Sp100 Nuclear Antigen (Sp100) Protein
20-abx168513
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Sp100 Nuclear Antigen (Sp100) Protein
20-abx069139
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SP100 antibody
70R-20465 50 ul
EUR 435
Description: Rabbit polyclonal SP100 antibody
SP100 Antibody
34867-100ul 100ul
EUR 252
SP100 Antibody
34867-50ul 50ul
EUR 187
SP100 Antibody
33089-100ul 100ul
EUR 252
SP100 Antibody
1-CSB-PA050127
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
SP100 Antibody
CSB-PA102856-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SP100 Antibody
CSB-PA102856-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SP100 Antibody
DF4247 200ul
EUR 304
Description: SP100 Antibody detects endogenous levels of total SP100.
SP100 Protein
20-abx262069
  • EUR 4838.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
SP100 Antibody
1-CSB-PA022439GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SP100 siRNA
20-abx934745
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SP100 Antibody
ABD4247 100 ug
EUR 438
anti-SP100
YF-PA14746 50 ug
EUR 363
Description: Mouse polyclonal to SP100
anti-SP100
YF-PA14747 100 ul
EUR 403
Description: Rabbit polyclonal to SP100
anti-SP100
YF-PA14748 100 ug
EUR 403
Description: Rabbit polyclonal to SP100
anti-SP100
YF-PA24757 50 ul
EUR 334
Description: Mouse polyclonal to SP100
anti-SP100
YF-PA27366 50 ul
EUR 363
Description: Mouse polyclonal to SP100
Pig SP100 Nuclear Antigen (SP100) ELISA Kit
abx360861-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human SP100 Nuclear Antigen (SP100) ELISA Kit
abx351520-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Monkey SP100 Nuclear Antigen (SP100) ELISA Kit
abx358814-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken SP100 Nuclear Antigen (SP100) ELISA Kit
abx355679-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit SP100 Nuclear Antigen (SP100) ELISA Kit
abx363509-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human)
4-PAA326Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100)
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse)
4-PAA326Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100)
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat)
4-PAA326Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100)
Human Sp100 Nuclear Antigen(Sp100)ELISA Kit
QY-E04582 96T
EUR 361
ELISA kit for Human Sp100 (Sp100 Nuclear Antigen)
E-EL-H0935 1 plate of 96 wells
EUR 534
  • Gentaur's Sp100 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Sp100. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Sp100 (Sp100 Nuclear Antigen) in samples from Serum, Plasma, Cell supernatant
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), APC
4-PAA326Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), Biotinylated
4-PAA326Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Biotin.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), Cy3
4-PAA326Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Cy3.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), FITC
4-PAA326Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with FITC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), HRP
4-PAA326Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with HRP.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), PE
4-PAA326Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with PE.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), APC
4-PAA326Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), Biotinylated
4-PAA326Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Biotin.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), Cy3
4-PAA326Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Cy3.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), FITC
4-PAA326Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with FITC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), HRP
4-PAA326Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with HRP.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), PE
4-PAA326Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with PE.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), APC
4-PAA326Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), Biotinylated
4-PAA326Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Biotin.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), Cy3
4-PAA326Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Cy3.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), FITC
4-PAA326Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with FITC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), HRP
4-PAA326Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with HRP.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), PE
4-PAA326Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with PE.
Recombinant Human SP100
7-06493 5µg Ask for price
Recombinant Human SP100
7-06494 1mg Ask for price
Recombinant Human SP100
7-06495 1mg Ask for price
SP100 Blocking Peptide
DF4247-BP 1mg
EUR 195
SP100 Conjugated Antibody
C33089 100ul
EUR 397
SP100 cloning plasmid
CSB-CL022439HU-10ug 10ug
EUR 514
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1443
  • Sequence: atggcaggtgggggcggcgacctgagcaccaggaggctgaatgaatgtatttcaccagtagcaaatgagatgaaccatcttcctgcacacagccacgatttgcaaaggatgttcacggaagaccagggtgtagatgacaggctgctctatgacattgtattcaagcacttcaaaa
  • Show more
Description: A cloning plasmid for the SP100 gene.
SP100 Rabbit pAb
A5851-100ul 100 ul
EUR 308
SP100 Rabbit pAb
A5851-200ul 200 ul
EUR 459
SP100 Rabbit pAb
A5851-20ul 20 ul
EUR 183
SP100 Rabbit pAb
A5851-50ul 50 ul
EUR 223
anti- SP100 antibody
FNab08132 100µg
EUR 585
  • Immunogen: SP100 nuclear antigen
  • Uniprot ID: P23497
  • Gene ID: 6672
  • Research Area: Metabolism
Description: Antibody raised against SP100
Anti-SP100 Antibody
PA2286 100ug/vial
EUR 294
Anti-SP100 antibody
PAab08132 100 ug
EUR 412
pCMV-SPORT6-SP100
PVT13979 2 ug
EUR 391
Anti-SP100 antibody
STJ28414 100 µl
EUR 277
Description: This gene encodes a subnuclear organelle and major component of the PML (promyelocytic leukemia)-SP100 nuclear bodies. PML and SP100 are covalently modified by the SUMO-1 modifier, which is considered crucial to nuclear body interactions. The encoded protein binds heterochromatin proteins and is thought to play a role in tumorigenesis, immunity, and gene regulation. Alternatively spliced variants have been identified for this gene; one of which encodes a high-mobility group protein.
Anti-SP100 (1G6)
YF-MA15559 100 ug
EUR 363
Description: Mouse monoclonal to SP100
Anti-SP100 (2E2)
YF-MA15560 100 ug
EUR 363
Description: Mouse monoclonal to SP100
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), APC-Cy7
4-PAA326Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC-Cy7.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA326Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC-Cy7.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), APC-Cy7
4-PAA326Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC-Cy7.
SP100 protein (His tag)
80-1387 1 mg
EUR 565
Description: Purified recombinant SP100 protein (His tag)
Human Sp100 ELISA Kit
EHS0163 96Tests
EUR 521
Bovine Sp100 ELISA Kit
EBS0163 96Tests
EUR 521
Anserini Sp100 ELISA Kit
EAS0163 96Tests
EUR 521