SP100

Sp100 Nuclear Antigen (Sp100) Antibody
20-abx128509
  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sp100 Nuclear Antigen (Sp100) Antibody
20-abx130241
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sp100 Nuclear Antigen (Sp100) Antibody
20-abx102294
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SP100 Nuclear Antigen (SP100) Antibody
20-abx004488
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SP100 Nuclear Antigen (SP100) Antibody
abx028278-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SP100 Nuclear Antigen (SP100) Antibody
abx028278-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SP100 Nuclear Antigen (SP100) Antibody
20-abx014668
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Sp100 Nuclear Antigen (SP100) Antibody
20-abx324693
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sp100 Nuclear Antigen (SP100) Antibody
abx331179-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
SP100 Nuclear Antigen (SP100) Antibody
abx238132-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Recombinant Sp100 Nuclear Antigen (Sp100)
4-RPA326Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23497
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Sp100 Nuclear Antigen expressed in: E.coli
Recombinant Sp100 Nuclear Antigen (Sp100)
4-RPA326Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35892
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: 10.4
Description: Recombinant Mouse Sp100 Nuclear Antigen expressed in: E.coli
Recombinant Sp100 Nuclear Antigen (Sp100)
4-RPA326Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5XI80
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.6kDa
  • Isoelectric Point: 5.8
Description: Recombinant Rat Sp100 Nuclear Antigen expressed in: E.coli
Mouse Sp100 Nuclear Antigen (Sp100) Protein
20-abx069139
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Sp100 Nuclear Antigen (Sp100) Protein
20-abx168513
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Sp100 Nuclear Antigen (Sp100) Protein
20-abx166555
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SP100 Protein
20-abx262069
  • EUR 4838.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
SP100 Antibody
ABD4247 100 ug
EUR 438
SP100 Antibody
34867-100ul 100ul
EUR 252
SP100 Antibody
34867-50ul 50ul
EUR 187
SP100 Antibody
33089-100ul 100ul
EUR 252
SP100 antibody
70R-20465 50 ul
EUR 435
Description: Rabbit polyclonal SP100 antibody
SP100 Antibody
DF4247 200ul
EUR 304
Description: SP100 Antibody detects endogenous levels of total SP100.
SP100 siRNA
20-abx934745
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SP100 Antibody
CSB-PA102856-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SP100 Antibody
CSB-PA102856-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SP100 Antibody
1-CSB-PA050127
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
SP100 Antibody
1-CSB-PA022439GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SP100. Recognizes SP100 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
anti-SP100
YF-PA14746 50 ug
EUR 363
Description: Mouse polyclonal to SP100
anti-SP100
YF-PA14747 100 ul
EUR 403
Description: Rabbit polyclonal to SP100
anti-SP100
YF-PA14748 100 ug
EUR 403
Description: Rabbit polyclonal to SP100
anti-SP100
YF-PA24757 50 ul
EUR 334
Description: Mouse polyclonal to SP100
anti-SP100
YF-PA27366 50 ul
EUR 363
Description: Mouse polyclonal to SP100
Pig SP100 Nuclear Antigen (SP100) ELISA Kit
abx360861-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit SP100 Nuclear Antigen (SP100) ELISA Kit
abx363509-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human SP100 Nuclear Antigen (SP100) ELISA Kit
abx351520-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Monkey SP100 Nuclear Antigen (SP100) ELISA Kit
abx358814-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken SP100 Nuclear Antigen (SP100) ELISA Kit
abx355679-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human)
4-PAA326Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100)
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse)
4-PAA326Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100)
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat)
4-PAA326Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100)
Human Sp100 Nuclear Antigen(Sp100)ELISA Kit
QY-E04582 96T
EUR 361
ELISA kit for Human Sp100 (Sp100 Nuclear Antigen)
E-EL-H0935 1 plate of 96 wells
EUR 534
  • Gentaur's Sp100 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Sp100. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Sp100 (Sp100 Nuclear Antigen) in samples from Serum, Plasma, Cell supernatant
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), APC
4-PAA326Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), Biotinylated
4-PAA326Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Biotin.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), Cy3
4-PAA326Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Cy3.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), FITC
4-PAA326Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with FITC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), HRP
4-PAA326Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with HRP.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), PE
4-PAA326Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with PE.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), APC
4-PAA326Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), Biotinylated
4-PAA326Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Biotin.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), Cy3
4-PAA326Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Cy3.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), FITC
4-PAA326Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with FITC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), HRP
4-PAA326Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with HRP.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), PE
4-PAA326Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with PE.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), APC
4-PAA326Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), Biotinylated
4-PAA326Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Biotin.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), Cy3
4-PAA326Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with Cy3.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), FITC
4-PAA326Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with FITC.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), HRP
4-PAA326Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with HRP.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), PE
4-PAA326Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with PE.
SP100 Conjugated Antibody
C33089 100ul
EUR 397
SP100 cloning plasmid
CSB-CL022439HU-10ug 10ug
EUR 514
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1443
  • Sequence: atggcaggtgggggcggcgacctgagcaccaggaggctgaatgaatgtatttcaccagtagcaaatgagatgaaccatcttcctgcacacagccacgatttgcaaaggatgttcacggaagaccagggtgtagatgacaggctgctctatgacattgtattcaagcacttcaaaa
  • Show more
Description: A cloning plasmid for the SP100 gene.
anti- SP100 antibody
FNab08132 100µg
EUR 585
  • Immunogen: SP100 nuclear antigen
  • Uniprot ID: P23497
  • Gene ID: 6672
  • Research Area: Metabolism
Description: Antibody raised against SP100
SP100 Rabbit pAb
A5851-100ul 100 ul
EUR 308
SP100 Rabbit pAb
A5851-200ul 200 ul
EUR 459
SP100 Rabbit pAb
A5851-20ul 20 ul
EUR 183
SP100 Rabbit pAb
A5851-50ul 50 ul
EUR 223
Recombinant Human SP100
7-06493 5µg Ask for price
Recombinant Human SP100
7-06494 1mg Ask for price
Recombinant Human SP100
7-06495 1mg Ask for price
SP100 Blocking Peptide
DF4247-BP 1mg
EUR 195
Anti-SP100 antibody
PAab08132 100 ug
EUR 412
Anti-SP100 Antibody
PA2286 100ug/vial
EUR 294
pCMV-SPORT6-SP100
PVT13979 2 ug
EUR 391
Anti-SP100 antibody
STJ28414 100 µl
EUR 277
Description: This gene encodes a subnuclear organelle and major component of the PML (promyelocytic leukemia)-SP100 nuclear bodies. PML and SP100 are covalently modified by the SUMO-1 modifier, which is considered crucial to nuclear body interactions. The encoded protein binds heterochromatin proteins and is thought to play a role in tumorigenesis, immunity, and gene regulation. Alternatively spliced variants have been identified for this gene; one of which encodes a high-mobility group protein.
Anti-SP100 (1G6)
YF-MA15559 100 ug
EUR 363
Description: Mouse monoclonal to SP100
Anti-SP100 (2E2)
YF-MA15560 100 ug
EUR 363
Description: Mouse monoclonal to SP100
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Human), APC-Cy7
4-PAA326Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Gly610~Lys802)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC-Cy7.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA326Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Thr261~Lys465)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC-Cy7.
Sp100 Nuclear Antigen (Sp100) Polyclonal Antibody (Rat), APC-Cy7
4-PAA326Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Sp100 (Phe116~Pro333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sp100 Nuclear Antigen (Sp100). This antibody is labeled with APC-Cy7.
Human Sp100 ELISA Kit
EHS0163 96Tests
EUR 521
Goat Sp100 ELISA Kit
EGTS0163 96Tests
EUR 521
Bovine Sp100 ELISA Kit
EBS0163 96Tests
EUR 521
Chicken Sp100 ELISA Kit
ECKS0163 96Tests
EUR 521