GCNT3

GCNT3 antibody

70R-1911 100 ug
EUR 377
Description: Rabbit polyclonal GCNT3 antibody

GCNT3 Antibody

34483-100ul 100ul
EUR 252

GCNT3 Antibody

34483-50ul 50ul
EUR 187

GCNT3 Antibody

1-CSB-PA070267
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

GCNT3 Antibody

CSB-PA976989-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

GCNT3 Antibody

CSB-PA976989-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

GCNT3 antibody

70R-35953 100 ug
EUR 327
Description: Rabbit polyclonal GCNT3 antibody

GCNT3 Antibody

1-CSB-PA009329LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

GCNT3 siRNA

20-abx902113
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCNT3 siRNA

20-abx917701
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCNT3 siRNA

20-abx917702
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pCDNA3.1-GCNT3

PVT18048 2 ug
EUR 258

GCNT3 Rabbit pAb

A13209-100ul 100 ul
EUR 308

GCNT3 Rabbit pAb

A13209-200ul 200 ul
EUR 459

GCNT3 Rabbit pAb

A13209-20ul 20 ul
EUR 183

GCNT3 Rabbit pAb

A13209-50ul 50 ul
EUR 223

GCNT3 Blocking Peptide

33R-1261 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAT13 antibody, catalog no. 70R-1206

GCNT3 Conjugated Antibody

C34483 100ul
EUR 397

GCNT3 cloning plasmid

CSB-CL009329HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1317
  • Sequence: atggttcaatggaagagactctgccagctgcattacttgtgggctctgggctgctatatgctgctggccactgtggctctgaaactttctttcaggttgaagtgtgactctgaccacttgggtctggagtccagggaatctcaaagccagtactgtaggaatatcttgtataatt
  • Show more
Description: A cloning plasmid for the GCNT3 gene.

GCNT3 Polyclonal Antibody

ABP56998-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GCNT3 at AA range: 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of GCNT3 from Human. This GCNT3 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GCNT3 at AA range: 200-280

GCNT3 Polyclonal Antibody

ABP56998-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GCNT3 at AA range: 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of GCNT3 from Human. This GCNT3 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GCNT3 at AA range: 200-280

GCNT3 Polyclonal Antibody

ABP56998-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GCNT3 at AA range: 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of GCNT3 from Human. This GCNT3 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GCNT3 at AA range: 200-280

GCNT3 Polyclonal Antibody

ES7997-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GCNT3 from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

GCNT3 Polyclonal Antibody

ES7997-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GCNT3 from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

pCMV-SPORT6-GCNT3

PVT13600 2 ug
EUR 391

Anti-GCNT3 antibody

STJ115175 100 µl
EUR 277
Description: This gene encodes a member of the N-acetylglucosaminyltransferase family. The encoded protein is a beta-6-N-acetylglucosamine-transferase that catalyzes the formation of core 2 and core 4 O-glycans on mucin-type glycoproteins.

Anti-GCNT3 antibody

STJ93241 200 µl
EUR 197
Description: Rabbit polyclonal to GCNT3.

Bovine GCNT3 ELISA KIT

ELI-09727b 96 Tests
EUR 928

Human GCNT3 ELISA KIT

ELI-30964h 96 Tests
EUR 824

Mouse Gcnt3 ELISA KIT

ELI-27111m 96 Tests
EUR 865

Polyclonal GCNT3 Antibody (Internal)

APR16099G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCNT3 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal GCNT3 Antibody (Internal)

APR16100G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCNT3 (Internal). This antibody is tested and proven to work in the following applications:

Rat GCNT3 shRNA Plasmid

20-abx988193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GCNT3 shRNA Plasmid

20-abx977658
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GCNT3 Antibody, HRP conjugated

1-CSB-PA009329LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GCNT3 Antibody, FITC conjugated

1-CSB-PA009329LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GCNT3 Antibody, Biotin conjugated

1-CSB-PA009329LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCNT3. Recognizes GCNT3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GCNT3 shRNA Plasmid

20-abx956120
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GCNT3 Recombinant Protein (Human)

RP013036 100 ug Ask for price

GCNT3 Recombinant Protein (Rat)

RP202397 100 ug Ask for price

GCNT3 Recombinant Protein (Mouse)

RP136175 100 ug Ask for price

Polyclonal GCNT3 Antibody (aa226-275)

APR16098G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCNT3 (aa226-275). This antibody is tested and proven to work in the following applications:

Polyclonal GCNT3 Antibody (N-term)

APR16109G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCNT3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal GCNT3 Antibody (N-Terminus)

APR16110G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCNT3 (N-Terminus). This antibody is tested and proven to work in the following applications:

Gcnt3 ORF Vector (Rat) (pORF)

ORF067467 1.0 ug DNA
EUR 506

GCNT3 ORF Vector (Human) (pORF)

ORF004346 1.0 ug DNA
EUR 95

Gcnt3 ORF Vector (Mouse) (pORF)

ORF045393 1.0 ug DNA
EUR 506

Gcnt3 sgRNA CRISPR Lentivector set (Rat)

K7143901 3 x 1.0 ug
EUR 339

Gcnt3 sgRNA CRISPR Lentivector set (Mouse)

K3447701 3 x 1.0 ug
EUR 339

GCNT3 sgRNA CRISPR Lentivector set (Human)

K0847901 3 x 1.0 ug
EUR 339

Gcnt3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7143902 1.0 ug DNA
EUR 154

Gcnt3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7143903 1.0 ug DNA
EUR 154

Gcnt3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7143904 1.0 ug DNA
EUR 154

Gcnt3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3447702 1.0 ug DNA
EUR 154

Gcnt3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3447703 1.0 ug DNA
EUR 154

Gcnt3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3447704 1.0 ug DNA
EUR 154

GCNT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0847902 1.0 ug DNA
EUR 154

GCNT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0847903 1.0 ug DNA
EUR 154

GCNT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0847904 1.0 ug DNA
EUR 154

GCNT3 Protein Vector (Rat) (pPB-C-His)

PV269866 500 ng
EUR 603

GCNT3 Protein Vector (Rat) (pPB-N-His)

PV269867 500 ng
EUR 603

GCNT3 Protein Vector (Rat) (pPM-C-HA)

PV269868 500 ng
EUR 603

GCNT3 Protein Vector (Rat) (pPM-C-His)

PV269869 500 ng
EUR 603

GCNT3 Protein Vector (Mouse) (pPB-C-His)

PV181570 500 ng
EUR 603

GCNT3 Protein Vector (Mouse) (pPB-N-His)

PV181571 500 ng
EUR 603

GCNT3 Protein Vector (Mouse) (pPM-C-HA)

PV181572 500 ng
EUR 603

GCNT3 Protein Vector (Mouse) (pPM-C-His)

PV181573 500 ng
EUR 603

GCNT3 Protein Vector (Human) (pPB-C-His)

PV017381 500 ng
EUR 329

GCNT3 Protein Vector (Human) (pPB-N-His)

PV017382 500 ng
EUR 329

GCNT3 Protein Vector (Human) (pPM-C-HA)

PV017383 500 ng
EUR 329