- Home
- Human DTNb(Dystrobrevin Beta) ELISA Kit
Human DTNb(Dystrobrevin Beta) ELISA Kit
Order Now: lieven@gentaur.com
Human Dystrobrevin Beta (DTNb) ELISA Kit |
RDR-DTNb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
RDR-DTNb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
RD-DTNb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
RD-DTNb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Dystrobrevin beta (DTNb) ELISA Kit |
20-abx151363 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dystrobrevin Beta (DTNb) ELISA Kit |
SEF385Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids. |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
SEF385Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids. |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
SEF385Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids. |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
SEF385Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids. |
Human Dystrobrevin Beta (DTNb) ELISA Kit |
4-SEF385Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dystrobrevin Beta elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dystrobrevin Beta (DTNb) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Dystrobrevin Beta (DTNB) Antibody |
20-abx210815 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystrobrevin Beta (DTNB) Antibody |
20-abx112211 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystrobrevin Beta (DTNb) Antibody |
20-abx130457 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dystrobrevin Beta (DTNB) Antibody |
abx122407-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dystrobrevin Beta (DTNb) Antibody |
20-abx172179 |
Abbexa |
|
|
|
Dystrobrevin Beta (DTNB) Antibody |
20-abx339607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystrobrevin Beta (DTNB) Antibody |
abx232551-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Dystrobrevin Beta (DTNb) |
4-RPF385Hu01 |
Cloud-Clone |
-
EUR 460.19
-
EUR 226.00
-
EUR 1450.72
-
EUR 550.24
-
EUR 1000.48
-
EUR 371.00
-
EUR 3476.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O60941
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Dystrobrevin Beta expressed in: E.coli |
Human Dystrobrevin Beta (DTNb) Protein |
20-abx650657 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1957.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Dystrobrevin beta (DTNb) CLIA Kit |
20-abx494887 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human DTNb (Dystrobrevin Beta) |
ELK3317 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dystrobrevin Beta (DTN?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dystrobre
- Show more
|
Description: A sandwich ELISA kit for detection of Dystrobrevin Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Dystrobrevin beta (DTNB) |
KTE61971-48T |
Abbkine |
48T |
EUR 332 |
- Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dystrobrevin beta (DTNB) |
KTE61971-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dystrobrevin beta (DTNB) |
KTE61971-96T |
Abbkine |
96T |
EUR 539 |
- Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human) |
4-PAF385Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb) |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC |
4-PAF385Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Biotinylated |
4-PAF385Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Biotin. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Cy3 |
4-PAF385Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Cy3. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), FITC |
4-PAF385Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with FITC. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), HRP |
4-PAF385Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with HRP. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), PE |
4-PAF385Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with PE. |
Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF385Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DTNb (Met1~Glu249)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC-Cy7. |
Recombinant human Dystrobrevin beta |
P2840 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: O60941
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Dystrobrevin beta |
anti-Dystrobrevin beta |
YF-PA11436 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Dystrobrevin beta |
anti-Dystrobrevin beta |
YF-PA11437 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Dystrobrevin beta |
anti-Dystrobrevin beta |
YF-PA23608 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Dystrobrevin beta |
Anti-Dystrobrevin beta (1D3) |
YF-MA12738 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Dystrobrevin beta |
DTNB ELISA Kit (Human) (OKCD00463) |
OKCD00463 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL |
DTNb ELISA Kit (Human) (OKDD00246) |
OKDD00246 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL |
Human Dystrobrevin Alpha (DTNA) ELISA Kit |
abx386993-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
DTNB antibody |
70R-16945 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DTNB antibody |
DTNB Antibody |
36425-100ul |
SAB |
100ul |
EUR 252 |
DTNB antibody |
10R-6896 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DTNB antibody |
DTNB antibody |
10R-6897 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DTNB antibody |
DTNB antibody |
10R-6898 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DTNB antibody |
DTNB antibody |
10R-6899 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DTNB antibody |
DTNB antibody |
10R-6900 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DTNB antibody |
DTNB Antibody |
1-CSB-PA756613 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
DTNB Antibody |
1-CSB-PA187891 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
DTNB antibody |
70R-3432 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DTNB antibody raised against the C terminal of DTNB |
DTNB Antibody |
1-CSB-PA007217GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DTNB siRNA |
20-abx901595 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DTNB siRNA |
20-abx914688 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DTNB siRNA |
20-abx914689 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit |
abx250983-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human DTNB shRNA Plasmid |
20-abx951286 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DTNB Recombinant Protein (Human) |
RP009880 |
ABM |
100 ug |
Ask for price |
anti-Dystrobrevin alpha |
YF-PA11433 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Dystrobrevin alpha |
anti-Dystrobrevin alpha |
YF-PA11434 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Dystrobrevin alpha |
anti-Dystrobrevin alpha |
YF-PA11435 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Dystrobrevin alpha |
DTNB Rabbit pAb |
A12866-100ul |
Abclonal |
100 ul |
EUR 308 |
DTNB Rabbit pAb |
A12866-200ul |
Abclonal |
200 ul |
EUR 459 |
DTNB Rabbit pAb |
A12866-20ul |
Abclonal |
20 ul |
EUR 183 |
DTNB Rabbit pAb |
A12866-50ul |
Abclonal |
50 ul |
EUR 223 |
DTNB Blocking Peptide |
33R-1524 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTNB antibody, catalog no. 70R-3432 |
DTNB Conjugated Antibody |
C36425 |
SAB |
100ul |
EUR 397 |
DTNB cloning plasmid |
CSB-CL007217HU-10ug |
Cusabio |
10ug |
EUR 581 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1683
- Sequence: atgattgaggaaagtgggaacaagcggaagaccatggcagagaagaggcagctgttcatagaaatgcgtgctcagaattttgatgtcatacgactatcaacttacagaacagcctgcaaattacgatttgtacaaaaacgatgcaaccttcatcttgttgatatctggaacatga
- Show more
|
Description: A cloning plasmid for the DTNB gene. |
anti- DTNB antibody |
FNab02551 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: dystrobrevin, beta
- Uniprot ID: O60941
- Gene ID: 1838
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against DTNB |
Anti-DTNB antibody |
STJ114732 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. |
DTNB (Ellman's Reagent) |
DB0113 |
Bio Basic |
5g |
EUR 97.85 |
- Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related
|
DTNB ORF Vector (Human) (pORF) |
ORF003294 |
ABM |
1.0 ug DNA |
EUR 95 |
Cow Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit |
abx517260-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit |
abx517261-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit |
abx517263-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit |
abx517264-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Dystrobrevin Alpha (DTNA) Antibody |
abx026894-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dystrobrevin Alpha (DTNA) Antibody |
abx026894-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dystrobrevin Alpha (DTNA) Antibody |
20-abx112210 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystrobrevin Alpha (DTNA) Antibody |
20-abx125789 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dystrobrevin Alpha (DTNA) Antibody |
abx232550-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Rat DTNB shRNA Plasmid |
20-abx990429 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DTNB shRNA Plasmid |
20-abx970075 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DTNB Recombinant Protein (Rat) |
RP198725 |
ABM |
100 ug |
Ask for price |
DTNB Recombinant Protein (Mouse) |
RP130163 |
ABM |
100 ug |
Ask for price |
DTNB Recombinant Protein (Mouse) |
RP130166 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
DTNB sgRNA CRISPR Lentivector set (Human) |
K0635701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Dtnb ORF Vector (Rat) (pORF) |
ORF066243 |
ABM |
1.0 ug DNA |
EUR 506 |
Dtnb ORF Vector (Mouse) (pORF) |
ORF043389 |
ABM |
1.0 ug DNA |
EUR 506 |
Dtnb ORF Vector (Mouse) (pORF) |
ORF043390 |
ABM |
1.0 ug DNA |
EUR 506 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
DTNB sgRNA CRISPR Lentivector (Human) (Target 1) |
K0635702 |
ABM |
1.0 ug DNA |
EUR 154 |
DTNB sgRNA CRISPR Lentivector (Human) (Target 2) |
K0635703 |
ABM |
1.0 ug DNA |
EUR 154 |
DTNB sgRNA CRISPR Lentivector (Human) (Target 3) |
K0635704 |
ABM |
1.0 ug DNA |
EUR 154 |
DTNB Protein Vector (Human) (pPB-C-His) |
PV013173 |
ABM |
500 ng |
EUR 329 |
DTNB Protein Vector (Human) (pPB-N-His) |
PV013174 |
ABM |
500 ng |
EUR 329 |
DTNB Protein Vector (Human) (pPM-C-HA) |
PV013175 |
ABM |
500 ng |
EUR 329 |
DTNB Protein Vector (Human) (pPM-C-His) |
PV013176 |
ABM |
500 ng |
EUR 329 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human beta Thromboglobulin (beta-TG) ELISA Kit |
20-abx150805 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human beta Thromboglobulin (beta-TG) ELISA Kit |
abx253830-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human beta Thromboglobulin (beta-TG) ELISA Kit |
abx253398-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Beta lactoglobulin, Beta-LG ELISA Kit |
ELA-E1023h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Beta-TG(Beta-thromboglobulin) ELISA Kit |
EH0874 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.312-20 ng/ml
- Alias: β-TG(β-Thromboglobulin)/Beta-TG
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human beta Thromboglobulin (beta-TG) ELISA Kit |
abx574328-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C |
7-04999 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C |
7-05000 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C |
7-05001 |
CHI Scientific |
1mg |
Ask for price |
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
20-abx210645 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
abx117130-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
20-abx130940 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
20-abx130941 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody |
abx031648-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody |
abx031648-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody |
abx031649-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody |
abx031649-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
abx028982-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
abx028982-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
20-abx339074 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
20-abx334159 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dystrobrevin Binding Protein 1 (DTNBP1) Antibody |
20-abx001375 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Recombinant Dystrobrevin Binding Protein 1 (DTNBP1) |
4-RPC444Hu01 |
Cloud-Clone |
-
EUR 279.20
-
EUR 178.00
-
EUR 772.00
-
EUR 324.00
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q96EV8
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.9kDa
- Isoelectric Point: 4.3
|
Description: Recombinant Human Dystrobrevin Binding Protein 1 expressed in: E.coli |
Recombinant Dystrobrevin Binding Protein 1 (DTNBP1) |
4-RPC444Mu01 |
Cloud-Clone |
-
EUR 386.72
-
EUR 206.00
-
EUR 1175.20
-
EUR 458.40
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q91WZ8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Dystrobrevin Binding Protein 1 expressed in: E.coli |
Recombinant Dystrobrevin Binding Protein 1 (DTNBP1) |
4-RPC444Ra01 |
Cloud-Clone |
-
EUR 395.68
-
EUR 209.00
-
EUR 1208.80
-
EUR 469.60
-
EUR 839.20
-
EUR 328.00
-
EUR 2872.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q5M834
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Dystrobrevin Binding Protein 1 expressed in: E.coli |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Dtnb sgRNA CRISPR Lentivector set (Mouse) |
K4670501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dtnb sgRNA CRISPR Lentivector set (Rat) |
K6438701 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Human Beta-Endorphin (Beta-EP) Kit |
KTE62451-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Beta-Endorphin (Beta-EP) Kit |
KTE62451-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Beta-Endorphin (Beta-EP) Kit |
KTE62451-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human IL1 beta ELISA kit |
55R-1605 |
Fitzgerald |
1 kit |
EUR 415 |
Description: ELISA kit for the detection of IL1 beta in the research laboratory |
Human TNF beta ELISA kit |
55R-1717 |
Fitzgerald |
1 kit |
EUR 415 |
Description: ELISA kit for the detection of TNF beta in the research laboratory |
Human IFN beta ELISA kit |
55R-2176 |
Fitzgerald |
96 tests |
EUR 766 |
Description: ELISA Kit for detection of IFNb in the research laboratory |
Human TNF beta ELISA kit |
55R-IB49601 |
Fitzgerald |
96 wells |
EUR 1178 |
Description: ELISA kit for the detection of TNF beta in the research laboratory |
Human IL1 beta ELISA kit |
55R-IB49624 |
Fitzgerald |
96 wells |
EUR 1178 |
Description: ELISA kit for the detection of IL1 beta in the research laboratory |
Human Beta-taxilin ELISA kit |
E01B0982-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Beta-taxilin ELISA kit |
E01B0982-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Beta-taxilin ELISA kit |
E01B0982-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Beta hydroxybutyrate ELISA kit |
E01B1010-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Beta hydroxybutyrate ELISA kit |
E01B1010-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Beta hydroxybutyrate ELISA kit |
E01B1010-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human beta Endorphin ELISA kit |
E01E0219-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human beta Endorphin ELISA kit |
E01E0219-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human beta Endorphin ELISA kit |
E01E0219-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human beta lactoglobulin ELISA kit |
E01L0012-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human beta lactoglobulin ELISA kit |
E01L0012-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human beta lactoglobulin ELISA kit |
E01L0012-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Beta-LI ELISA Kit |
EHB0653 |
Abclonal |
96Tests |
EUR 521 |
Human Beta-naphthol ELISA Kit |
CN-04545H1 |
ChemNorm |
96T |
EUR 441 |
Human Beta-naphthol ELISA Kit |
CN-04545H2 |
ChemNorm |
48T |
EUR 291 |
Beta-NGF (human) ELISA Kit |
K4787-100 |
Biovision |
100 assays |
EUR 834 |
- Kit components:
- Beta-NGF Ab coated plate (Item A), 96 wells
- Wash Buffer Concentrate (20x) (Item B)
- Human Beta-NGF Standard (Item C)
- Assay Diluent (5x) (Item E)
- Biotinylated anti-human Beta-NGF Ab (Item F)
- HRP-Streptavidin Concentrate (8
- Show more
|
Description: Sensitive, Colorimetric Assay |