brefeldin a

Brefeldin A

B1400-25 25 mg
EUR 270
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B1400-5 5 mg
EUR 108
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B1400-5.1 10 mM (in 1mL DMSO)
EUR 119
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B1400-S Evaluation Sample
EUR 81
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B012-50MG 50 mg
EUR 335

Brefeldin A

B012-5MG 5 mg
EUR 114

Brefeldin A

HY-16592 10mM/1mL
EUR 126

Brefeldin A

GA2848-100MG 100 mg
EUR 660

Brefeldin A

GA2848-10MG 10 mg
EUR 134

Brefeldin A

GA2848-25MG 25 mg
EUR 229

Brefeldin A

GA2848-50MG 50 mg
EUR 389

Brefeldin A

GA2848-5MG 5 mg
EUR 102

Brefeldin A

20-abx076735
  • EUR 606.00
  • EUR 286.00
  • 25 mg
  • 5 mg
  • Shipped within 5-12 working days.

Brefeldin A

1560-5
EUR 156

Brefeldin A

1560-50
EUR 468

EZSolution? Brefeldin A

B1872-5
EUR 164

Brefeldin A, >99%

BC011-010 10mg
EUR 219

Brefeldin A, >99%

BC011-025 25mg
EUR 300

Brefeldin A, >99%

BC011-050 50mg
EUR 435

Brefeldin A (GEF inhibitor)

SIH-225-25MG 25 mg
EUR 289
  • Brefeldin A is a reversible inhibitor of proteins from the endoplasmic reticulum (ER) to the golgi. In mammalian and yeast cells, Brefeldin A targets certain GTP-exchange factosr responsible for activating a GTPase called Arf1p (1, 2).
Description: The substance Brefeldin A is a gef inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white crystalline solid which is soluble to 10 mM in ethanol and to 50 mM in DMSO.

Brefeldin A (GEF inhibitor)

SIH-225-5MG 5 mg
EUR 121
  • Brefeldin A is a reversible inhibitor of proteins from the endoplasmic reticulum (ER) to the golgi. In mammalian and yeast cells, Brefeldin A targets certain GTP-exchange factosr responsible for activating a GTPase called Arf1p (1, 2).
Description: The substance Brefeldin A is a gef inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white crystalline solid which is soluble to 10 mM in ethanol and to 50 mM in DMSO.

ARFGEF1 ELISA Kit| Bovine Brefeldin A-inhibited guanine nucleot

EF011099 96 Tests
EUR 689

Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) Antibody

20-abx006208
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) Antibody

20-abx321298
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) Antibody

abx233372-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) ELISA Kit

abx387507-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Goat Anti-Human Apolipoprotein A-IV A(ApoA4) peptid IgG, aff pure

APOA45-A 100 ul
EUR 482

Rabbit Anti-human MART-1/Melanocyte Differentiation-A/Melan-A peptide (CT) IgG

MART12-A 100 ul
EUR 445

Boc-a-Me-DL-Val-OH

A-4145.0001 1.0g
EUR 139
Description: Sum Formula: C11H21NO4; CAS# [139938-00-4]

Boc-a-Me-DL-Val-OH

A-4145.0005 5.0g
EUR 477
Description: Sum Formula: C11H21NO4; CAS# [139938-00-4]

Rabbit Anti-Influenza A HA (H1N1, 1-343aa) (A/Wyoming/3/03) protein IgG, aff pure

H3N22-A 100 ul
EUR 445

Fmoc-a-amino-DL-Gly(Boc)-OH

A-4320.0001 1.0g
EUR 273
Description: Sum Formula: C22H24N2O6; CAS# [176039-39-7]

Fmoc-a-amino-DL-Gly(Boc)-OH

A-4320.0005 5.0g
EUR 998
Description: Sum Formula: C22H24N2O6; CAS# [176039-39-7]

Chicken Anti-Protein A IgG, aff pure

PRTA11-A 1 mg
EUR 482

Goat Anti-Protein-A IgG aff pure

PRTA12-A 0.1 ml
EUR 408

Chicken Anti-Protein-A IgG aff pure

PRTA13-A 100 ug
EUR 408

Rabbit Anti-Influenza A nucleoprotein (H1N1-NP/1-320aa) protein (A/06/California/2009) IgG, aff pure

H1NP21-A 100 ul
EUR 445

Rabbit Anti-Influenza A HA2 (H5N1) (A/Vietnam/1203/2004 366-531aa, >95%, his-tag) protein IgG

HA2H012-A 100 ul
EUR 445

Rabbit Anti-Influenza A HA (H3N2, 1-531aa/HA1+HA2) (A/Brisbane/10/2007) protein IgG, aff pure

H3N23-A 100 ul
EUR 445

Goat Anti-Hepatitis A Virus (Strain HM175) IgG

HAV11-A 100 ul
EUR 457

Goat Anti-human Serum Amyloid A (SAA) antiserum

SAA11-A 100 ul
EUR 482

Rabbit Anti-Streptococcus A IgG, aff pure, #2

STA12-A 1 mg
EUR 286

Rabbit Anti-Human Calcineurin A-subunit IgG aff pure

CALNA12-A 100 ug
EUR 482

Chicken Anti-Human+Mouse IgG+A+M IgG/Y

HGAM11-A 100 ul
EUR 482

Hematoxylin, Weigert's Iron (Part A)

HWI-A-250 250 ml
EUR 116

Rabbit Anti-Human Apolipoprotein A-I protein IgG, aff pure

APOA12-A 100 ug
EUR 482

Rabbit Anti-Mouse Apolipoprotein A-I protein IgG, aff pure

APOA13-A 100 ug
EUR 482

Goat Anti-Human Apolipoprotein A-Il protein IgG, aff pure

APOA21-A 100 ug
EUR 482

Goat Anti-Green Fluorescent Proteins (GFP, A. victoria) protein, IgG

GFP11-A 100 ul
EUR 408

Rabbit Anti-Mouse a-1-Acid Glycoprotein IgG, aff pure

A1AG18-A 100 ug
EUR 482

Rabbit Anti-Rat a-1-Acid Glycoprotein IgG, aff pure

A1AG19-A 100 ug
EUR 482

Rabbit Anti-Mouse prepro Orexin A IgG # 1, aff pure

PPOX11-A 100 ul
EUR 482

Rabbit Anti-Rat/Human Orexin-A IgG # 1, aff pure

OXA11-A 100 ug
EUR 482

Rabbit Anti-Influenza A hemeagglutinin A2 (HA2/stem or stalk domain/347-523aa) protein (A/Viet Nam/1203/2004(H5N1) IgG, aff pure

HA28-A 100 ul
EUR 445

Rabbit Anti-Hemagglutinin HA1 Influenza A Virus (H11N2; A/duck/Yangzhou/906/2002) IgG

H11N2-01-A 100 ul
EUR 482

Rabbit Anti-bovine Calcineurin (A+B subunits) protein, IgG, aff pure

CALN11-A 100 ug
EUR 482

Rabbit Anti-Borrelia burgdorferi Osp-A protein (OspA) IgG, aff pure

OSPA12-A 100 ul
EUR 482

Rabbit Anti-Hemagglutinin Influenza A Virus H1N1 H1 (H1N1) (A/New Caledonia/20/99) IgG

H1N1-01-A 100 ul
EUR 482

Goat Anti-Human/mouse/rat Insulin chain A peptide IgG, aff pure

INSA21-A 100 ul
EUR 482

Rabbit Anti-Rat neurite outgrowth inhibitor (Nogo-A) IgG #1, aff. pure

NogoA11-A 100 ug
EUR 482

Goat Anti-Human recombinant Fetuin A (Alpha-2 HS-Glycoprotein, AHSG, A2HS) IgG

FETB12-A 100 ug
EUR 482

Rabbit Anti-Rat Epithelial Na Channel alpha (ENAC-a) IgG #1, Aff. Pure

ENACa11-A 100 ug
EUR 482

Rabbit Anti-Human Neurite outgrowth inhibitor (Nogo A-C) IgG #2, aff. pure

NogoA12-A 100 ug
EUR 482

Rabbit Anti-Influenza A virus HA IgG (aff pure)

AB-23091-A 100ug
EUR 482

Rabbit anti-E-coli host cell proteins (HCP's) IgG, aff pure (a mix of rabbit and Chicken Ig's)

ECO12-A 100 ul
EUR 482

Rabbit Anti-Human Ephrin type-A receptor 2 (EPHA2) (EPHA2- phosphor) IgG (aff pure)

AB-23084-A 100ug
EUR 482

Rabbit Anti-Human Pleckstrin homology domain containing, family A member 7 (PLEKHA7) IgG (aff pure)

AB-23061-A 100 ug
EUR 482

"sans-serif""">

a--centractin 96 Tests
EUR 100

Rabbit Anti-Hemagglutinin Influenza A Virus H1N1 H1 (Pan H1N1 reacts with multiple strains of H1N1) IgG, purified

H1N1-02-A 100 ul
EUR 482

A-F-A

5-00518 4 x 5mg Ask for price

A-H-A

5-00520 4 x 5mg Ask for price

A-L-A

5-00522 4 x 5mg Ask for price

A-H-A Peptide

20-abx265711
  • EUR 328.00
  • EUR 495.00
  • EUR 272.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

A-L-A Peptide

20-abx265713
  • EUR 328.00
  • EUR 495.00
  • EUR 272.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

A-F-A Peptide

20-abx265720
  • EUR 328.00
  • EUR 495.00
  • EUR 272.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

A-L-a-L

5-00523 4 x 5mg Ask for price

NPR-A/GC-A/ Rat NPR- A/ GC- A ELISA Kit

ELA-E2129r 96 Tests
EUR 886

A-a-A-Y-G-G-F-L

5-00517 4 x 5mg Ask for price

Protein A Standards A-H

F743 1 ml
EUR 411
  • Product category: Quality control/standard for molecular biology applications
Description: Protein A Standards A-H by Cygnus Technologies is available in Europe via Gentaur.

Concanavalin A (Con A) Antibody

20-abx101152
  • EUR 272.00
  • EUR 133.00
  • EUR 676.00
  • EUR 342.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

A-L-A-L Peptide

20-abx265733
  • EUR 328.00
  • EUR 495.00
  • EUR 272.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Torsin A (Torsin A) Antibody

abx238876-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NELF-A (NELF-A) Antibody

abx235656-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

A-A-A-Y-G-G-F-L Peptide

20-abx265866
  • EUR 356.00
  • EUR 537.00
  • EUR 286.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Small Nuclear Ribonucleoprotein A (U1 snRNP A, RNP-A) Antibody

31362-05111 150 ug
EUR 261

Protein A Standards Set, A-E

F053 1 ml
EUR 411
  • Product category: Quality control/standard for molecular biology applications
Description: Protein A Standards Set, A-E by Cygnus Technologies is available in Europe via Gentaur.

Protein A Standards Set, A-G

F403 1 ml
EUR 411
  • Product category: Quality control/standard for molecular biology applications
Description: Protein A Standards Set, A-G by Cygnus Technologies is available in Europe via Gentaur.

Peptidylprolyl Isomerase A (Cyclophilin A) Antibody

20-abx114380
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen A (HLA-A) Antibody

20-abx001779
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen A (HLA-A) Antibody

20-abx141675
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

batf

BATF antibody

70R-15963 50 ul
EUR 435
Description: Rabbit polyclonal BATF antibody

BATF Antibody

33911-100ul 100ul
EUR 252

BATF Antibody

33911-50ul 50ul
EUR 187

BATF Antibody

46333-100ul 100ul
EUR 252

BATF Antibody

1-CSB-PA002570GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

BATF Antibody

CSB-PA109532-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

BATF Antibody

CSB-PA109532-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

BATF Antibody

1-CSB-PA619074LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BATF Antibody

1-CSB-PA006625
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BATF Antibody

AF0722 200ul
EUR 304
Description: BATF Antibody detects endogenous levels of BATF.

BATF siRNA

20-abx900598
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BATF siRNA

20-abx908899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BATF siRNA

20-abx908900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BATF Antibody

ABF0722 100 ug
EUR 438

anti-BATF

YF-PA17035 50 ug
EUR 363
Description: Mouse polyclonal to BATF

anti-BATF

YF-PA17036 100 ug
EUR 403
Description: Rabbit polyclonal to BATF

anti-BATF

YF-PA25608 50 ul
EUR 334
Description: Mouse polyclonal to BATF

BATF Rabbit pAb

A14667-100ul 100 ul
EUR 308

BATF Rabbit pAb

A14667-200ul 200 ul
EUR 459

BATF Rabbit pAb

A14667-20ul 20 ul
EUR 183

BATF Rabbit pAb

A14667-50ul 50 ul
EUR 223

Human BATF Antibody

32089-05111 150 ug
EUR 261

BATF Blocking Peptide

20-abx161297
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

BATF Blocking Peptide

AF0722-BP 1mg
EUR 195

BATF Conjugated Antibody

C33911 100ul
EUR 397

BATF cloning plasmid

CSB-CL619074HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atgcctcacagctccgacagcagtgactccagcttcagccgctctcctccccctggcaaacaggactcatctgatgatgtgagaagagttcagaggagggagaaaaatcgtattgccgcccagaagagccgacagaggcagacacagaaggccgacaccctgcacctggagagcga
  • Show more
Description: A cloning plasmid for the BATF gene.

BATF Polyclonal Antibody

A58242 100 µg
EUR 570.55
Description: Ask the seller for details

BATF Rabbit pAb

A8907-100ul 100 ul
EUR 308

BATF Rabbit pAb

A8907-200ul 200 ul
EUR 459

BATF Rabbit pAb

A8907-20ul 20 ul Ask for price

BATF Rabbit pAb

A8907-50ul 50 ul Ask for price

anti- BATF antibody

FNab00807 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:10-1:100
  • Immunogen: basic leucine zipper transcription factor, ATF-like
  • Uniprot ID: Q16520
  • Gene ID: 10538
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against BATF

Anti-BATF antibody

PAab00807 100 ug
EUR 355

Anti-BATF antibody

STJ111472 100 µl
EUR 277
Description: The protein encoded by this gene is a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. The leucine zipper of this protein mediates dimerization with members of the Jun family of proteins. This protein is thought to be a negative regulator of AP-1/ATF transcriptional events.

Anti-BATF antibody

STJ116871 100 µl
EUR 277
Description: The protein encoded by this gene is a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. The leucine zipper of this protein mediates dimerization with members of the Jun family of proteins. This protein is thought to be a negative regulator of AP-1/ATF transcriptional events.

Anti-BATF antibody

STJ72996 100 µg
EUR 260

Anti-BATF (8A12)

YF-MA11295 100 ug
EUR 363
Description: Mouse monoclonal to BATF

Anti-BATF (1G4)

YF-MA17359 100 ug
EUR 363
Description: Mouse monoclonal to BATF

BATF Antibody, HRP conjugated

1-CSB-PA619074LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BATF Antibody, FITC conjugated

1-CSB-PA619074LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BATF Antibody, Biotin conjugated

1-CSB-PA619074LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

BATF protein (His tag)

80R-1687 100 ug
EUR 305
Description: Purified recombinant Human BATF protein

Human BATF ELISA Kit

EHB0645 96Tests
EUR 521

Goat BATF ELISA Kit

EGTB0645 96Tests
EUR 521

Bovine BATF ELISA Kit

EBB0645 96Tests
EUR 521

Canine BATF ELISA Kit

ECB0645 96Tests
EUR 521

Anserini BATF ELISA Kit

EAB0645 96Tests
EUR 521

BATF ELISA KIT|Human

EF008067 96 Tests
EUR 689

Rat BATF shRNA Plasmid

20-abx988982
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BATF shRNA Plasmid

20-abx974311
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

brdu

BrdU/ Rat BrdU ELISA Kit

ELA-E1336r 96 Tests
EUR 886

BRDU antibody

20R-BS001 250 ug
EUR 553
Description: Sheep polyclonal BRDU antibody

BRDU antibody

10R-2321 1 mL
EUR 601
Description: Mouse monoclonal BRDU antibody

BRDU antibody

10R-2356 1.5 mL
EUR 490
Description: Mouse monoclonal BRDU antibody

BRDU antibody

20-BS17 250 ug
EUR 386
Description: Sheep polyclonal BRDU antibody

BRDU antibody

10R-6763 1 ml
EUR 402
Description: Mouse monoclonal BRDU antibody

BRDU antibody

10R-7945 100 ug
EUR 370
Description: Mouse monoclonal BRDU antibody

BRDU antibody

10R-B121a 100 ug
EUR 445
Description: Mouse monoclonal BRDU antibody

5-BrdU

B3589-1000 1 g
EUR 142
Description: 5-Bromodeoxyuridine (5-BrdU) is an analog of Thy that is incorporated into the DNA of cells undergoing the S-phase and can be detected by monoclonal antibodies or polyclona111.

5-BrdU

B3589-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: 5-Bromodeoxyuridine (5-BrdU) is an analog of Thy that is incorporated into the DNA of cells undergoing the S-phase and can be detected by monoclonal antibodies or polyclona111.

5-BrdU

B3589-500 500 mg
EUR 108
Description: 5-Bromodeoxyuridine (5-BrdU) is an analog of Thy that is incorporated into the DNA of cells undergoing the S-phase and can be detected by monoclonal antibodies or polyclona111.

anti-BrdU

BROF-100T 100 test
EUR 537.5

5-BrdU

HY-15910 5g
EUR 497

BrdU (Bu20a) Antibody

48275-100ul 100ul
EUR 333

BrdU (Bu20a) Antibody

48275-50ul 50ul
EUR 239

Anti-BrdU Antibody

A1284-100
EUR 398

Anti-BrdU Purified

11-286-C025 0.025 mg
EUR 108

Anti-BrdU Purified

11-286-C100 0.1 mg
EUR 177

Anti-BrdU Purified

11-682-C025 0.025 mg
EUR 108

Anti-BrdU Purified

11-682-C100 0.1 mg
EUR 177

Anti-BrdU PE

1P-682-T025 25 tests
EUR 140

Anti-BrdU PE

1P-682-T100 100 tests
EUR 240

BRDU antibody (FITC)

61R-1900 1 ml
EUR 409
Description: Mouse monoclonal BRDU antibody (FITC)

Bromodeoxyuridine (BrdU) Antibody

abx412356-50ug 50 ug
EUR 509
  • Shipped within 1 week.

Bromodeoxyuridine (BrdU) Antibody

abx414257-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Bromodeoxyuridine (BrdU) Antibody

abx414259-01mg 0.1 mg
EUR 439
  • Shipped within 1 week.

Bromodeoxyuridine (BrdU) Antibody

abx414260-20ug 20 ug
EUR 272
  • Shipped within 1 week.

Bromodeoxyuridine (BrdU) Antibody

abx230952-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

BrdU Mouse mAb

A1482-100ul 100 ul
EUR 308

BrdU Mouse mAb

A1482-200ul 200 ul Ask for price

BrdU Mouse mAb

A1482-20ul 20 ul Ask for price

BrdU Mouse mAb

A1482-50ul 50 ul
EUR 223

Bromodeoxyuridine (BrdU) Antibody

abx000064-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

anti- BrdU antibody

FNab00952 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:200-1:1000
  • IF: 1:50-1:500
  • Immunogen: compound
  • Research Area: Epigenetics, Neuroscience, Cell Division and Proliferation
Description: Antibody raised against BrdU

Anti-BrdU antibody

STJ16101064 100 µg
EUR 354

Anti-BrdU antibody

STJ22838 100 µl
EUR 277

Bromodeoxyuridine (BrdU) Antibody (FITC)

abx201100-100tests 100 tests
EUR 620
  • Shipped within 2-3 weeks.

Human BrDU ELISA Kit

EHB0693 96Tests
EUR 521

Mouse BrdU ELISA Kit

ELA-E1336m 96 Tests
EUR 865

Goat BrDU ELISA Kit

EGTB0693 96Tests
EUR 521

Bovine BrDU ELISA Kit

EBB0693 96Tests
EUR 521

Canine BrDU ELISA Kit

ECB0693 96Tests
EUR 521

Chicken BrDU ELISA Kit

ECKB0693 96Tests
EUR 521

Anserini BrDU ELISA Kit

EAB0693 96Tests
EUR 521

BrdU (Bu20a) Conjugated Antibody

C48275 100ul
EUR 397

BrdU (Bromodeoxyuridine)(BRD469) Antibody

BNUB0469-100 100uL
EUR 209
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD469), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(BRD469) Antibody

BNUB0469-500 500uL
EUR 458
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD469), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(BRD494) Antibody

BNUB0494-100 100uL
EUR 209
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD494), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(BRD494) Antibody

BNUB0494-500 500uL
EUR 458
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD494), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(BU20a) Antibody

BNUB0522-100 100uL
EUR 209
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BU20a), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(BU20a) Antibody

BNUB0522-500 500uL
EUR 458
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BU20a), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(BRD469) Antibody

BNUM0469-50 50uL
EUR 395
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD469), 1mg/mL

BrdU (Bromodeoxyuridine)(BRD494) Antibody

BNUM0494-50 50uL
EUR 395
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD494), 1mg/mL

BrdU (Bromodeoxyuridine)(BU20a) Antibody

BNUM0522-50 50uL
EUR 395
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BU20a), 1mg/mL

Bromodeoxyuridine (BrdU) Antibody (FITC)

abx414258-50ug 50 ug
EUR 342
  • Shipped within 1 week.

Mouse BrDU ELISA Kit

EMB0693 96Tests
EUR 521

Rat BrDU ELISA Kit

ERB0693 96Tests
EUR 521

Sheep BrDU ELISA Kit

ESB0693 96Tests
EUR 521

Rabbit BrDU ELISA Kit

ERTB0693 96Tests
EUR 521

Monkey BrDU ELISA Kit

EMKB0693 96Tests
EUR 521

Porcine BrDU ELISA Kit

EPB0693 96Tests
EUR 521

Human Bromodeoxyuridine,BrdU ELISA Kit

201-12-1904 96 tests
EUR 440
  • This Bromodeoxyuridine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Anti-Bromodeoxyuridine (BrdU) Antibody (SPM166)

A1449-100
EUR 479

5-Bromo-2'-deoxyuridine (BrdU)

40024 100MG
EUR 109
Description: Minimum order quantity: 1 unit of 100MG

Rat Anti Brdu Monoclonal Antibody

DMABT-50291RB 20 µg
EUR 429

Rat Anti Brdu Monoclonal Antibody

DMABT-50292RB 0.2 mg
EUR 741

Rat Anti Brdu Monoclonal Antibody

DMABT-50293RB 0.1 mg
EUR 663

Mouse Anti Brdu Monoclonal Antibody

DMABT-50295MB 20 µg
EUR 445

Mouse Anti Brdu Monoclonal Antibody

DMABT-50296MB 0.2 mg
EUR 715

Rat Anti Brdu Monoclonal Antibody

DMABT-50297RB 0.25 ml
EUR 1173

Rat Anti Brdu Monoclonal Antibody

DMABT-50299RB 0.25 mg
EUR 751

Rat Anti Brdu Monoclonal Antibody

DMABT-50300RB 0.5 mg
EUR 1193

Rat Anti Brdu Monoclonal Antibody

DMABT-50301RB 5 ml
EUR 892

BRDU antibody (Prediluted for IHC)

75R-1006 7 ml
EUR 225
Description: Mouse monoclonal BRDU antibody (Prediluted for IHC)

Guinea Pig BrDU ELISA Kit

EGB0693 96Tests
EUR 521

CytoSelect BrdU Competitive ELISA Kit

CBA-5098 96 assays
EUR 543

Rat Bromodeoxyuridine,BrdU ELISA Kit

CN-01657R1 96T
EUR 447

Rat Bromodeoxyuridine,BrdU ELISA Kit

CN-01657R2 48T
EUR 296

Mouse Bromodeoxyuridine,BrdU ELISA Kit

CN-02530M1 96T
EUR 471

Mouse Bromodeoxyuridine,BrdU ELISA Kit

CN-02530M2 48T
EUR 322

Human Bromodeoxyuridine,BrdU ELISA Kit

CN-04581H1 96T
EUR 471

Human Bromodeoxyuridine,BrdU ELISA Kit

CN-04581H2 48T
EUR 322

BrdU (Bromodeoxyuridine)(MoBu-1) Antibody

BNUM0884-50 50uL
EUR 395
Description: Primary antibody against BrdU (Bromodeoxyuridine)(MoBu-1), 1mg/mL

BrdU (Bromodeoxyuridine)(BRD.3) Antibody

BNUM0885-50 50uL
EUR 395
Description: Primary antibody against BrdU (Bromodeoxyuridine)(BRD.3), 1mg/mL

BrdU (Bromodeoxyuridine)(85-2C8) Antibody

BNUM0886-50 50uL
EUR 395
Description: Primary antibody against BrdU (Bromodeoxyuridine)(85-2C8), 1mg/mL

BrdU Cell Proliferation Assay Kit

C0300-050 500 Assays
EUR 928

BrdU Cell Proliferation Assay Kit

C0300-100 1000 Assays
EUR 1312

BrdU Cell Proliferation Assay Kit

C0300-500 5000 Assays
EUR 4438

BrdU (Bromodeoxyuridine)(MoBu-1) Antibody

BNUB0884-100 100uL
EUR 209
Description: Primary antibody against BrdU (Bromodeoxyuridine)(MoBu-1), Concentration: 0.2mg/mL

BrdU (Bromodeoxyuridine)(MoBu-1) Antibody

BNUB0884-500 500uL
EUR 458
Description: Primary antibody against BrdU (Bromodeoxyuridine)(MoBu-1), Concentration: 0.2mg/mL

brefeldin

Brefeldin A

B1400-25 25 mg
EUR 270
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B1400-5 5 mg
EUR 108
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B1400-5.1 10 mM (in 1mL DMSO)
EUR 119
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B1400-S Evaluation Sample
EUR 81
Description: Brefeldin A (BFA) is an inhibitor of ATPase with IC50 value of 0.2 ?M [1]ATPase is a chemical enzyme which is essential in the ADP/ATP exchange which process provides chemical potential energy.

Brefeldin A

B012-50MG 50 mg
EUR 335

Brefeldin A

B012-5MG 5 mg
EUR 114

Brefeldin A

HY-16592 10mM/1mL
EUR 126

Brefeldin A

GA2848-100MG 100 mg
EUR 660

Brefeldin A

GA2848-10MG 10 mg
EUR 134

Brefeldin A

GA2848-25MG 25 mg
EUR 229

Brefeldin A

GA2848-50MG 50 mg
EUR 389

Brefeldin A

GA2848-5MG 5 mg
EUR 102

Brefeldin A

20-abx076735
  • EUR 606.00
  • EUR 286.00
  • 25 mg
  • 5 mg
  • Shipped within 5-12 working days.

Brefeldin A

1560-5
EUR 156

Brefeldin A

1560-50
EUR 468

EZSolution? Brefeldin A

B1872-5
EUR 164

Brefeldin A, >99%

BC011-010 10mg
EUR 219

Brefeldin A, >99%

BC011-025 25mg
EUR 300

Brefeldin A, >99%

BC011-050 50mg
EUR 435

Brefeldin A (GEF inhibitor)

SIH-225-25MG 25 mg
EUR 289
  • Brefeldin A is a reversible inhibitor of proteins from the endoplasmic reticulum (ER) to the golgi. In mammalian and yeast cells, Brefeldin A targets certain GTP-exchange factosr responsible for activating a GTPase called Arf1p (1, 2).
Description: The substance Brefeldin A is a gef inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white crystalline solid which is soluble to 10 mM in ethanol and to 50 mM in DMSO.

Brefeldin A (GEF inhibitor)

SIH-225-5MG 5 mg
EUR 121
  • Brefeldin A is a reversible inhibitor of proteins from the endoplasmic reticulum (ER) to the golgi. In mammalian and yeast cells, Brefeldin A targets certain GTP-exchange factosr responsible for activating a GTPase called Arf1p (1, 2).
Description: The substance Brefeldin A is a gef inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white crystalline solid which is soluble to 10 mM in ethanol and to 50 mM in DMSO.

ARFGEF1 ELISA Kit| Bovine Brefeldin A-inhibited guanine nucleot

EF011099 96 Tests
EUR 689

Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) Antibody

20-abx006208
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) Antibody

20-abx321298
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) Antibody

abx233372-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Golgi-Specific Brefeldin A-Resistance Guanine Nucleotide Exchange Factor 1 (GBF1) ELISA Kit

abx387507-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

bd spectrum

Spectrum Agar

CP044-010 1 Kg Ask for price

pGBKT7-BD

PVT4017 2 ug
EUR 241

Soyasaponin Bd

TBZ2948 5mg Ask for price

Broad Spectrum Phosphatase Inhibitor Cocktail

AR1183 1mL
EUR 80

0.6ML MICROTUBES IN SPECTRUM PACK

MCT-060-SP 1000/pk
EUR 205
Description: Micro Tubes; Micro Tubes Push Cap- Axygen

1.7ML MICROTUBES IN SPECTRUM PACK

MCT-175-SP 500/pk
EUR 130
Description: Micro Tubes; Micro Tubes Push Cap- Axygen

2.0ML MICROTUBES IN SPECTRUM PACK

MCT-200-SP 500/pk
EUR 130
Description: Micro Tubes; Micro Tubes Push Cap- Axygen

Tropodithietic acid (Broad spectrum antibiotic)

SIH-566-1MG 1 mg
EUR 243
Description: The substance Tropodithietic acid is a broad spectrum antibiotic. It is synthetically produced and has a purity of >98%. The pure substance is orange powder which is May be dissolved in DMSO (5 mg/ml).

Broad Spectrum Protease Inhibitor Cocktail (100x)

AR1182 1mLX2
EUR 101

BD-2 Antibody

5372-100
EUR 338

OXF BD 02

B4918-10 10 mg
EUR 350

OXF BD 02

B4918-50 50 mg
EUR 1314

BD 1047 dihydrobromide

B1069-10
EUR 175

BD 1047 dihydrobromide

B1069-50
EUR 544

BD 1008 dihydrobromide

B6330-10 10 mg
EUR 189
Description: BD 1008 dihydrobromide is a potent and selective ligand for ?-receptor with Ki values of 2 and 8 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2 [2].

BD 1008 dihydrobromide

B6330-5 5 mg
EUR 134
Description: BD 1008 dihydrobromide is a potent and selective ligand for ?-receptor with Ki values of 2 and 8 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2 [2].

BD 1008 dihydrobromide

B6330-50 50 mg
EUR 676
Description: BD 1008 dihydrobromide is a potent and selective ligand for ?-receptor with Ki values of 2 and 8 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2 [2].

BD 1063 dihydrochloride

B6489-10 10 mg
EUR 171
Description: BD 1063 dihydrochloride is an antagonist of ?-1 receptor with Ki value of 9.15 nM [1].?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.?-1 receptor plays an important role in stimulating dopamine release and modulating the actions of cocaine [2].

BD 1063 dihydrochloride

B6489-5 5 mg
EUR 126
Description: BD 1063 dihydrochloride is an antagonist of ?-1 receptor with Ki value of 9.15 nM [1].?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.?-1 receptor plays an important role in stimulating dopamine release and modulating the actions of cocaine [2].

Apoa5 (bd) Antibody

abx015771-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

BD 1047 dihydrobromide

B6521-10 10 mg
EUR 187
Description: BD 1047 dihydrobromide is an antagonist of ?1 receptor with Ki values of 0.93 and 47 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.

BD 1047 dihydrobromide

B6521-25 25 mg
EUR 355
Description: BD 1047 dihydrobromide is an antagonist of ?1 receptor with Ki values of 0.93 and 47 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.

BD 1047 dihydrobromide

B6521-5 5 mg
EUR 126
Description: BD 1047 dihydrobromide is an antagonist of ?1 receptor with Ki values of 0.93 and 47 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.

BD-AcAc 2

HY-15344 100mg
EUR 641

BD-1047 (dihydrobromide)

HY-16996A 10mg
EUR 173

BD-1, Human

HY-P7133 50ug
EUR 612

BD-1, Rat

HY-P7134 50ug
EUR 612

BD-2, Human

HY-P7135 50ug
EUR 533

BD-2, Mouse

HY-P7136 50ug
EUR 533

BD-3, Human

HY-P7137 50ug
EUR 533

BD-3, Mouse

HY-P7138 10ug
EUR 268

BD-3, Rat

HY-P7139 10ug
EUR 268

BD-4, Human

HY-P7140 50ug
EUR 533

BD-4, Rat

HY-P7141 50ug
EUR 533

4L Uniscint BD

NAT1410 4L
EUR 204

20L Uniscint BD

NAT1412 20L
EUR 772

BD-1, rat

RC260-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-3, rat

RC260-14 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-4, rat

RC260-15 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

1.5ML BOIL-PROOF MICROTUBES IN SPECTRUM PACK.

MCT-150-SP 500/pk
EUR 120
Description: Micro Tubes; Micro Tubes Push Cap- Axygen

BD-1, human recombinant

4506-1000
EUR 3258

BD-1, human recombinant

4506-20
EUR 256

BD-3, human recombinant

4524-1000
EUR 3203

BD-3, human recombinant

4524-20
EUR 245

BD-4, human recombinant

4525-1000
EUR 3203

BD-4, human recombinant

4525-20
EUR 256

BD-2, human recombinant

4372-1000
EUR 3856

BD-2, human recombinant

4372-20
EUR 245

BD-1, murine (mouse)

RC230-12 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-3, murine (mouse)

RC230-14 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Defensins