Antikroppar

Antikroppar

Affinitetskromatografi: En kromatografisk teknik som utnyttjar biologiska molekylers förmåga att binda till vissa ligander, specifikt och reversibelt. Tekniken används i proteinkemi.
Agglutinationstester: Undersökningar som bygger på att celler, mikroorganismer eller partiklar klumpar ihop sig när de blandas med specifikt antiserum.
Aminosyrasekvens: Aminosyrors ordningsföljd i en polypeptidkedja. Den utgör proteiners primärstruktur och är av avgörande betydelses för proteinkonfigurationen.
Antibodies, Monoclonal, Humanized
Antibodies, Monoclonal, Murine-Derived
Antibodies, Neutralizing
Antifosfolipidantikroppar: Autoantikroppar riktade mot fosfolipider. Dessa antikroppar förekommer typiskt hos patienter med systemisk lupus erythematosus SLE), antifosfolipidsyndromet, liknande autoimmuna sjukdomar och vissa i cke-autoimmuna sjukdomar. Också hos friska individer kan de förekomma.
Antifosfolipidsyndrom: Förekomst av antikroppar mot fosfolipider antifosfolipidantikroppar). Ett flertal sjukdomar har samband med detta tillstånd, däribland systemisk lupus erythematosus SLE) och andra bindvävssjukdomar, trombopeni och artär- eller ventromboser. Vid graviditet kan det orsaka abort. Halterna av antikardiolipinantikroppar är påtagligt höga.
Antigen-antikroppskomplex: Det aggregat som bildas när antigen- och antikroppsmolekyler förenas. Vävnadsskador till följd av avsättning av stora antigen-antikroppskomplex orsakar immunkomplexsjukdomar.
Antigen-antikroppsreaktioner: Reaktioner som uppstår till följd av antigen-antikroppskomplexbildning och leder till svullnad och inflammation.
Antigener
Anti-idiotypiska antikroppar: Antikroppar som reagerar med enskilda determinanter idiotoper) i den variabla regionen av andra antikroppar.
Antikroppar med dubbel specificitet: Antikroppar, ofta monoklonala, vars två antigenbindande strukturer är specifika för olika antigena determinanter. De är konstgjorda antikroppar, framställda genom kemisk korslänkning, sammansmältning av hybridomceller eller med molekylärgenetisk teknik. De används som målsökande bärare av bl a toxiner, läkemedel och radioisotoper.
Antikroppar: Immunglobulinmolekyler proteiner), vars specifika aminosyrasekvenser får dem att reagera endast med de antigen som utlöste deras syntetisering i celler i lymfocytserien i sht plasmaceller), eller me d närbesläktade antigen. Antikroppar klassificeras efter sitt sätt att verka: agglutininer, hemolysiner, opsoniner, precipitiner m fl.
Antikroppsaffinitet: Ett mått på styrkan av bindningen mellan en antikropp och ett enkelt hapten eller en antigendeterminant. Den beror på den stereokemiska passningen mellan en antikropps anslutningsplatser och de antige na determinanterna, på anslutningsytans storlek och på fördelningen av laddade och hydrofoba grupper.
Antikroppsbildning
Antikroppsmångfald: Den enorma variationsrikedom antikroppar kännetecknas av, och som tillåter immunsystemet att reagera specifikt med med det i stort sett obegränsade antal olika antigen det möter. Det finns tre huvudte orier för att förklara antikroppsdiversifieringen: 1)embryonalcellsteorien, som säger att varje antikroppsproducerande cell har gener som kodar för alla tänkbara antigena specificiteter; 2) mutationst eorien, som säger att de antikroppsproducerande cellerna endast innehåller ett fåtal gener, som åstadkommer diversifiering genom mutation; 3) omkastningsteorien
Antikroppsproducerande celler: Lymfoida celler som kan reagera med antigen så att specifika cellprodukter, kallade antikroppar, bildas. Olika undergrupper av celler, ofta B-lymfocyter, kan särskiljas, utifrån de olika immunglobulin klasser de ger upphov till.
Antikroppsspecificitet: Egenskap som gör att antikroppar kan reagera med vissa antigena determinanter och inte med andra. Specificiteten beror på kemisk sammansättning, fysikaliska krafter och bindningsplatsens molekylära st ruktur.
Antineutrofila cytoplasmaantikroppar: Autoantikroppar riktade mot cytoplasmakomponenter i polymorfonukleära leukocyter eller monocyter. De används som specifika markörer för Wegeners granulomatos och andra sjukdomar. Deras fysiopatologisk a roll är dock inte klarlagd.
Antinukleära antikroppar: Autoantikroppar riktade mot olika antigen i cellkärnor, så som DNA, RNA, histoner, sura kärnproteiner eller komplex av sådana molekyler. Antinukleära antikroppar förekommer i systemiska, autoimmuna sj ukdomar, som t ex systemisk lupus erythematosus SLE), Sjögrens syndrom, skleroderma, polymyosit och blandad bindvävssjukdom.
Artsspecificitet
Autoantigener: Antigener som, trots att de utgörs av beståndsdelar av normal kroppsvävnad, blir måltavla för ett humoralt eller cellförmedlat immunsvar.
Autoantikroppar: Antikroppar riktade mot kroppsegna antigener, dvs mot normala vävnadsdelar.
Autoimmuna sjukdomar: Sjukdomstillstånd kännetecknade av produktion av antikroppar som regerar mot ämnen i den egna kroppen.
Bakteriella antigener
Bakteriella antikroppar: Immunglobuliner framkallade av bakteriella antigena komponenter.
Bakteriella vacciner: Suspensionspreparat framställda av försvagade eller avdödade bakterier för förebyggande eller behandling av bakteriella infektionssjukdomar.
Bakteriella yttermembranproteiner: Proteiner förekommande i det yttre membranet hos bakterier.
Bakterieproteiner: Proteiner förekommande hos någon bakterieart.
Bärarproteiner: Proteiner som transporterar specifika ämnen i blodet eller genom cellväggar.
Bassekvens: Purin- och pyrimidinföljden i nukleinsyror och polynukleotider. Kallas även nukleotid- eller nukleosidsekvens.
beta 2-glykoprotein I
Bidning, kompetitiv
Bindningsplatser på antikroppar: Ytområden på antikroppar som reagerar med antigeners determinantområden. De bildas av delar av de variabla områdena i immunglobulinernas Fab-fragment.
Bindningsplatser: De reaktiva områden på en makromolekyl som är direkt envolverade i dess specifika sammankoppling med en annan molekyl.
Blockerande antikroppar: Antikroppar som hindrar reaktionen mellan antigen och andra antikroppar eller aktiverade T-lymfocyter t ex IgG-antikroppar som konkurrerar med IgE-antikroppar om antigen och därmed blockerar ett alle rgisvar). Blockerande antikroppar kan binda till tumörer och förhindra att cytotoxiska T-lymfocyter förstör tumörcellerna.
Blotting, Western: Blot-metod för identifiering av proteiner eller peptider som separerats med elektrofores och överförts till nitrocellulosastrimlor och sedan påvisas med hjälp av radioistopmärkta antikroppar.
B-lymfocyter: Lymfoida celler, även kallade B-celler, verksamma i det humorala immunförsvaret. B-cellerna är kortlivade och bildas i stora mängder i människokroppen. De har fått sitt namn pga likheten med celler fr ån fåglarnas bursa. Vid stimulering producerar B-cellerna antikroppar, dock endast av en sort, som sprids i kroppsvätskorna.
CD-antigener: Differentieringsantigener på humana leukocyter. CD är förkortning för “cluster of differentiation”, vilket syftar på grupper av monoklonala antikroppar som reagerar på likartat sätt med vissa undergru pper av antigener. Undergrupperna av antigener har samma CD-beteckning.
Celldelning: En cells förökning genom delning.
Celler, odlade: Celler som drivs fram in vitro i odlingsmedia som främjar deras tillväxt. Odlade celler används bl a för studier av utveckling, morfologi, metaboliska, fysiologiska och genetiska processer.
Cellinje
Cellmembran: Det fett- och proteinhaltiga, och selektivt genomsläppliga, membran som omger cytoplasman i prokaryota och eukaryota celler. Hos de flesta typer av mikrobiella celler gränsar den utåt till cellväggen.
Cellvidhäftning: Cellers förmåga att fästa vid ytor eller andra celler. Syn. celladhesion.
Cytotoxicitet, antikroppsberoende: Antikroppsförmedlad destruktion av målceller genom icke-sensibiliserade effektorceller. Målcellens identitet kan variera, men den måste ha yt-IgG med intakt Fc-del. Effektorcellen är en mördarcell med FC-receptorer, och den kan utgöras av en lymfocyt i avsaknad av vanliga B- eller T-cellmarkörer, en monocyt, makrofag eller polynukleär leukocyt. Reaktionen är komplementberoende.
DNA: En deoxiribonukleotidpolymer som utgör den grundläggande genetiska substansen i alla celler. Eukaryota och prokaryota organismer har normalt sitt DNA ordnat i dubbelsträngade strukturer, men i många viktiga biologiska processer ingår under vissa skeden enkla strängar. DNA, som består av en flersockerarts-fosfatstam med utskott av puriner adenin och guanin) och pyrimidiner tymin och cytosin), bildar en dubbelspiral som hålls ihop med vätebindningar mellan purinerna och pyrimidinerna adenin mot tymin AT) och guanin mot cytosin GC)).
Dos-responskurva, immunologisk: Det specifika immunsvar som utlöses av en specifik dos av ett immunologiskt aktivt ämne eller immunologiskt aktiv cell hos en organism, vävnad eller cell.
Elektronmikroskopi: Visuell eller fotografisk mikroskopi, där elektronstrålar med våglängder tusentals gånger kortare än synligt ljus) används i stället för ljus, vilket ger avsevärt större förstoring. Elektronernas interaktion med preparaten ger upplysning om preparatens finstruktur. Vid transmissionselektronmikroskopi ger elektronernas reaktioner under passage genom ett mycket tunt preparat upphov till en bild. Vid svepelektronmikroskopi faller en elektronstråle snett mot preparatytan, och av reaktionerna ovan ytan alstras en bild. Elektronmikroskopi förkortas ofta EM.
Enzymimmunologiska metoder: Immunologiska analysmetoder baserade på bruk av: 1) enzym-antikroppkonjugat; 2) enzym-antigenkonjugat; 3) antienzymantikroppar med efterföljande homologt enzym; 4) enzym-antienzymkomplex. Dessa används i histologiskt arbete för att synliggöra eller märka vävnadsprov.
Enzymkopplad immunadsorberande analys: En immunanalysmetod som utnyttjar en antikropp med enzymmarkör, t ex pepparrotsperoxidas. Då antingen enzymet eller antikroppen binds till ett adsorberande substrat behåller båda sin biologiska aktivitet. Förändringen i enzymaktivitet till följd av enzym-antikropp-antigenreaktionen är proportionell mot mängden antigen och kan mätas med spektrofotometri eller med blotta ögat. Det har utvecklats många varianter av metoden. Syn. ELISA.
Epitoper, B-lymfocyt: Antigena determinanter som känns igen av och binds till B-cellreceptorn. Epitoper som känns igen av B-cellreceptorer sitter på antigenets yta.
Epitoper: Områden på ett antigen som reagerar med specifika antikroppar.
Epitopkartläggning: Metoder för undersökning av antikroppsbindning till bestämda områden på antigena proteiner. Epitopkartläggning tillämpas framförallt vid immunkemiska analyser. Syn. epitopmappning.
Får
Färgning och märkning
Fc-receptorer: Molekyler på ytan av en del B-lymfocyter, T-lymfocyter och makrofager som känner igen och binder till Fc-delen på immunglobulinmolekyler.
Flödescytometri: En mätteknik som utnyttjar en maskin för att göra, bearbeta och presentera en eller fler mätningar på enstaka celler ur en cellsuspension. Cellerna färgas vanligen med något fluorescent färgämne som är specifikt för de cellkomponenter som undersöks, t ex DNA, och fluorescensen hos varje cell mäts då den snabbt passerar aktiveringsstrålen laser eller kvicksilverlampa). Fluorescensen ger ett kvantitativt mått på olika biokemiska och biofysiska egenskaper hos cellen, och utgör även en grund för cellsortering. Andra mätbara optiska parametrar är bl a ljusabsorption och ljusspridning, varav den senare kan användas för mätning av cellstorlek, form, täthet, kornighet och färgupptagning.
Gangliosider: En undergrupp sura glykosfingolipider. De innehåller en eller fler sialinsyra N-acetylneuraminsyra)rester. Men Svennerholms förkortningssystem benämns gangliosiderna G, med indexbokstäverna M, D eller T för mono, di- eller trisialo, och en siffra för att ange rörelsesekvensen i tunnskiktskromatogram.
Getter: Alla medlemmar av släktet Capra, lättrörliga idisslare med ihåliga horn. De är nära besläktade med får.
Glykoproteiner: Konjugerade protein-kolväteföreningar, omfattande bl a muciner, mukoida och amyloida glykoproteiner.
Graviditet: Tillståndet som följer på föreningen av en äggcell och en sädescell, då ett embryo eller foster växer i kroppen.
Haptener: Små, antigena faktorer som förmår framkalla ett immunsvar endast när de kopplats till en bärarmolekyl. Haptener binder till antikroppar, men kan i sig själva inte aktivera en immunreaktion.
Hemagglutinationsinhibitionstester: Serologiska tester där en given mängd antigen blandas med serum innan en lösning med röda blodkroppar tillsätts. Reaktionsresultatet uttrycks som den minsta mängd antigen som ger fullständig hemagglutinationshämning.
Hemagglutinationstester: Känsliga tester för mätning av vissa antigen, antikroppar eller virus som baseras på dessas förmåga att agglutinera vissa röda blodkroppar.
Hemocyanin: Kopparinnehållande, syretransporterande protein som finns i hemolymfan hos vissa ryggradslösa djur. Proteinet är färglöst i frånvaro av syre, men är blått i oxiderad form. Till skillnad från hemoglobin innehåller hemocyanin ingen hem-del, varför namnet egentligen är missvisande. 2004-10-05 Källa Nationalencyklopedin. http://www.ne.se/jsp/search/article.jsp?i_art_id=201478)
Hepatit B-antikroppar: Antikroppar mot hepatit B-antigen, inklusive antikroppar mot ytantigen Australienantigen) och kärnantigen hos Dane-partikeln, samt mot e-antigen.
Hepatit C-antikroppar: Antikroppar mot hepatit C-antigen, inklusive hölje-, kärn- och icke-strukturella proteiner.
Heterofila antikroppar: Antikroppar som framkallats hos en annan art än den från vilken antigenet härrör. Dessa antikroppar är riktade mot ett stort antal antigen som förekommer hos flera arter. De mest kända är Forssman, Ha nganutziu-Deicher H-D) och Paul-Bunnell P-B). Incidensen av dessa antikroppar är av betydelse i ett flertal patogenetiska sammanhang, såväl för serodiagnos som prognos.
HIV-1: Typarten för Lentivirus och orsaken till immunbristsyndromet AIDS. Virusets kännetecken är dess cytopatiska effekt och affinitet för T4-lymfocyter.
HIV-antikroppar: Antikroppar mot antigen från immunbristviruset HIV, tidigare benämnt HTLV-III/LAV.
HIV-höljeprotein gp120: Yttre höljeprotein hos HIV som kodas av virusets env-gen. Proteinet har molekylvikten är 120 kD och innehållerett antal glykosyleringsställen. Gp120 binder till celler som uttrycker CD4-cellyteantigener, främst T4-lymfocyter och monocyter/makrofager. CD4 stör den normala funktionen hos CD4 och är delvis orsak till HIVs cytopatiska effekt.
Hybridom: Celler framställda på konstlad väg genom sammansmältning av aktiverade lymfocyter och tumörceller. De erhållna hybridcellerna klonas och producerar s k monoklonala antikroppar eller T-cellprodukter, identiska med dem som produceras av den immunologiskt kompetenta ursprungscellen, och växer och förökar sig som den ursprungliga tumörcellen.
Immunanalys: Immunkemiskt test eller påvisande av ett ämne med serologiska eller immunologiska metoder. Vanligtvis tjänar det undersökta ämnet som antigen både för antikroppsproduktion och för antikroppsmätning.
Immundiffusion: En teknik som bygger på diffusion av antigen eller antikroppar genom ett halvfast medium, vanligen agar eller agarosgel, med en precipitinreaktion som resultat.
Immunelektrofores: En teknik som kombinerar proteinelektrofores och dubbel immundiffusion. Under processen separeras först proteiner med gelelektrofores vanligtvis agaros), för att därefter synliggöras genom immundiffusion av specifika antikroppar. En distinkt, elliptisk precipitinbåge framträder för varje protein som påvisas med antisera.
Immunelektronmikroskopi: Undersökning i elektronmikroskop av prover som först färgats på immunocytokemisk väg. Tekniken används i stor utsträckning vid virologisk diagnostik som en del av mycket känsliga immunologiska tester.
Immunfluorescensteknik, direkt: En immunfluorescensteknik som utnyttjar en fluorescerande färg bunden till en antikropp, vilken tillsätts direkt i en vävnads- eller cellösning för påvisande av specifikt antigen.
Immunfluorescensteknik, indirekt: En immunfluorescensteknik som används allmänt för påvisande av serumantikroppar och immunkomplex i kroppsvävnad och mikroorganismer i prov från patienter med infektionssjukdomar. Tekniken innebär framställning av antigen-antikroppskomplex, som märks med fluoresceinkonjugerade antiimmunglobulinantikroppar.
Immunfluorescensteknik: Analysmetod för vävnadsantigener, antingen direkt, genom konjugering av antikroppar med fluorescensfärg, eller indirekt, genom framställning av antigen-antikroppskomplex, som sedan märks med fluoresceinkonjugerade antiimmunglobulinantikroppar. Provet undersöks därpå i fluorescensmikroskop.
Immunglobulin A, sekretoriskt: Det dominerande immunglobulinet i exokrina sekret, så som mjölk, andningsvägarnas och tarmarnas slem, saliv och tårar. Den kompletta molekylen ca 400 kD) består av två IgA-enheter med fyra kedjor, en sekretorisk komponent och en J-kedja.
Immunglobulin A: IgA utgör 15-20% av människans serumimmunglobuliner, huvudsakligen i form av polymerer med 4 kedjor. Hos andra däggdjur dominerar dimerer. Sekretoriskt immunglobulin A är det vanligaste immunglobulinet i sekret.
Immunglobulin E: Ett immunglobulin som är kopplat till mastceller.
Immunglobulin G: Det dominerande immunglobulinet i normalt humanserum.
Immunglobulin M: En immunglobulinklass med mykedjor. IgM kan fixera komplement. Beteckningen har givits pga den höga molekylvikten; ursprungligen benämndes proteinet makroglobulin.
Immunglobulin, lätt kedja: Polypeptidkedjor, bestående av 211 till 217 aminosyrasekvenser, som kan isoleras från immunglobuliner och som har en molekylvikt av ca 22 kD. Det finns två huvudtyper av lätta kedjor, kappa och lambda, vilka hos människa förekommer ungefär i förhållandet 60% till 40%. Båda kedjor består av linjärt upprepade, likartade, men inte identiska, segment av ca 110 aminosyrarester. I varje segment lägger en disulfidbindning grunden till en tätt veckad, 60-delad slinga eller domän. Angränsande domäner länkas med mindre tätveckade regioner. Båda de lätta kedjorna innehåller två sådana domäner. Två lätta och två tunga kedjor utgör en immunglobulinmolekyl, men båda lätta kedjor i ett Ig är av samma typ.
Immunglobulin, tung kedja: Viktiga beståndsdelar av immunglobulinmolekyler. De utgör de större av de två typerna av polypeptidkedjor som svarar för de olika immunglobulinernas biologiska och immunologiska egenskaper. De skiljer sig åt, beroende på vilken Ig-klass de kommer från, innehåller mellan 450 och 600 aminosyrarester per kedja, och har molekylvikter mellan 51 och 72 kD. Varje immunglobulinmolekyl har två tunga och två lätta kedjor.
Immunglobuliner: Glykoproteiner som förekommer i blod antikroppar) och andra vävnader. De klassificeras utifrån struktur och verkan i fem klasser IgA, IgD, IgE, IgG och IgM).
Immunglobulinfragment
Immunglobulinfragment, Fab: Antigenbindande enheter bestående av en komplett lätt kedja och ungefär en halv tung kedja, hoplänkade med disulfidbindningar. Fab innehåller den antigenbindande plats som är en del av det variabla området på immunglobulinmolekylen.
Immunglobulinfragment, Fc: Kristalliserande fragment bestående av karboxiändarna av båda de tunga kedjorna, länkade med disulfidbindningar. Fc-fragmenten svarar för antikropparnas effektorfunktioner komplementfixering, cellmembranbindning och transport genom moderkakan).
Immunglobulinidiotyper: Unika, genetiskt reglerade determinanter på antikroppar, vars specificitet är begränsad till en enda proteingrupp t ex en annan antikroppsmolekyl eller ett enstaka myelomprotein). Idiotypen tycks representera antigeniciteten hos det antigenbindande området på antikroppen och ha samma genetiska förutbestämdhet. De idiotypiska determinanterna har lokaliserats exakt till det variabla Ig-området på båda polypeptidkedjorna.
Immunglobulinisotyper: De immunglobulinklasser som återfinns hos någon djurart. Hos människor finns det nio klasser som vandrar i fem olika grupper vid elektrofores. Var och en av dem består av två lätta och två tunga proteinkedjor, och varje grupp har sina utmärkande strukturella och funktionella egenskaper.
Immunhistokemi: Histokemiskt påvisande av immunreaktiva ämnen med hjälp av märkta antikroppar.
Immunisering, passiv
Immunisering, sekundär: Immunisering/vaccination som ges efter en primär immunisering med samma eller närbesläktat antigen.
Immunisering: Avsiktlig stimulering av värdens immunsvar. Aktiv immunisering innebär tillförsel av antigen eller immunologiska adjuvantia. Passiv immunisering innebär tillförsel av immunsera eller lymfocyter eller deras produkter t ex transferfaktor, immun-RNA) eller transplantation av immuncellproducerande vävnad tymus eller benmärg).
Immunitet, cellulär: De immunreaktioner som förmedlas av antigenaktiverade T-lymfocyter via lymfokiner eller direkt celltoxicitet. Detta sker utan förekomst av cirkulerande antikroppar eller i fall där antikroppar spelar en underordnad roll.
Immunitet, förvärvad från modern: Motståndskraft mot ett sjukdomsalstrande smittämne förvärvad genom att moderns immunitet överförts till fostret via moderkakan eller till det nyfödda barnen med modersmjölken.
Immunity, Humoral
Immunkemi: En gren inom kemin med inriktning på immunologiska fenomen och undersökning av kemiska reaktioner i samband med antigenstimulering av vävnader. Vetenskapen omfattar även fysikalisk-kemiska reaktioner mellan antigen och antikroppar.
Immunmodulerande medel: Substanser som förstärker, stimulerar, aktiverar eller modulerar såväl det cellulära som humorala immunsvaret. De klassiska medlen Freunds adjuvans, BCG, Corynebacterium parvum m fl) innehåller bakteriella antigener. Några är endogena t ex histamin, interferon, transfer factor, interleukin-1). De kan vara antingen ospecifika eller antigenspecifika.
Immunoblot: Immunologisk metod för påvisande eller kvantifiering av immunreaktiva ämnen.
Immunologiska metoder
Immunsera: Serum som innehåller antikroppar. Det erhålls från djur som immuniserats genom injektion av antigen eller genom infektion med mikroorganismer, bärande på antigenet.
Immunsorbenttekniker: Immunologiska tekniker för avskiljande av specifika antikroppar eller antigen genom adsorption och efterföljande sköljning, med bruk av en immunsorbent innehållande homologa antigen eller antikroppar.
Immunterapi: Manipulering av en individs immunsystem i syfte att behandla sjukdom. Hit hör såväl aktiv som passiv immunisering och immundämpande behandling för att förhindra avstötning av transplantat.
Immuntoxiner: Halvsyntetiska konjugat av olika toxiska molekyler, inkl. radioisotoper och bakterie- eller växtgifter, tillsammans med specifika immunämnen som immunglobuliner, monoklonala antikroppar och antigen. Det immunologiska antitumör- eller antivirusämnet bär med toxinet till tumören eller den infekterade cellen, där giftet utövar sin verkan.
Indiumradiosotoper: Instabila isotoper av indium som avger strålning under sönderfall. Indiumatomer med atomvikterna 106-112, 113m, 114 och 116-124 är radioaktiva isotoper.
Insulinantikroppar
Isoantikroppar: Antikroppar från en individ som reagerar med isoantigen från annan individ av samma art.
Jodradioisotoper: Instabila isotoper av jod som sönderfaller och avger strålning. Jodatomer med atomvikter mellan 117 och 139, med undantag av I-127, är radioaktiva jodisotoper.
Kaniner: Djurarten Oryctolagus cuniculus, av familjen Leporidae och ordningen Lagomorpha. Kaniner föds i hålor, utan päls, och med slutna ögon och öron. Kaniner har 22 kromosompar, medan harar har 24.
Katalytiska antikroppar: Antikroppar som kan katalysera ett flertal olika kemiska reaktioner. De kännetecknas av hög substratspecificitet, med verkningsmekanismer som på många sätt liknar enzymers.
Kinetik: Läran om förloppsdynamik i kemiska och fysikaliska system.
Kloning, molekylär: Tillförsel av molekyler av rekombinant DNA från prokaryota eller eukaryota källor till replikationsvektorer, så som plasmider eller virus, och införande av de härvid erhållna hybridmolekylerna i mottagarceller, utan att livsdugligheten hos dessa celler ändras.
Kolibakterie: En art gramnegativa, fakultativt anaeroba och stavformade bakterier som normalt förekommer i den nedre delen av tarmkanalen hos varmblodiga djur. Vanligtvis är den inte patogen, men vissa stammar kan ge upphov till diarré och variga infektioner. Syn. E. coli.
Komplementfixeringstest: Serologiska test baserade på inaktivering av komplement med antigen-antikroppkomplex steg 1). Bindning av fritt komplement kan synliggöras genom tillförsel av ett andra antigen-antikroppsystem, såsom röda blodkroppar och någon lämplig erytrocytantikropp hemolysin), som kräver komplement för att kunna bildas steg 2). Om de röda cellerna inte lyseras löses upp) tyder detta på att en specifik antigen-antikroppsreaktion har skett i steg 1. Om, däremot, de röda blodkropparna löses upp, så betyder det att det finns fritt komplement, vilket visar att ingen antigen-antikroppsreaktion ägt rum i steg 1.
Komplementproteiner: Serumglykoproteiner som deltar i den immunförsvarsmekanism som kallas komplementaktivering och som ger upphov till membranattackkomplexet. Häri ingår glykoproteiner i olika komplementaktiveringsprocesser den klassiska, den alternativa och lektinkomplementprocessen).
Korsreaktioner: Serologiska reaktioner som inträffar när ett antiserum mot ett antigen reagerar med ett annat, närbesläktat antigen.
Kycklingar: Vanlig benämning för arten Gallus gallus, tamfjäderfä inom familjen Phasianidae och ordningen Galliformes.
Lipopolysackarider: Fettbärande polysackarider som är endotoxiner och viktiga gruppspecifika antigen. De kommer ofta från cellväggen på gramnegativa bakterier och framkallar utsöndring av immunglobuliner. Lipopolysackaridmolekylen består av tre delar: lipid A, kärnpolysackarid och O-specifika kedjor O-antigen). Lipopolysackarider från Escherichia coli används ofta som polyklonala B-cedllsmitogen i laboratorieimmunologi.
Lymfocytaktivering: Morfologisk förändring av små lymfocyter i odling till stora, blast-liknande celler med förmåga att syntetisera DNA och RNA och till mitos. Aktivering säts igång av interleukiner, mitogener som t ex fytohemagglutininer) och pecifika antigen. Aktivering kan även ske in vivo, så som vid vävnadsavstötning och kronisk myeloid leukemi.
Lymfocyter: Vita blodkroppar som bildas i kroppens lymfvävnad. Cellkärnan är rund eller äggformad, med oregelbundet hopklumpat kromatin, medan cytoplasman är typiskt blekblå med azurofila om befintliga) korn. De flesta lymfocyter kan klassificeras som T- eller B-celler inklusive undergrupper). De som inte passar in någon av de två huvudgrupperna kallas nollceller.
Membranglykoproteiner: Glykoproteiner i cellmembran eller på cellytor.
Membranproteiner: Proteiner i biologiska membran, som t ex cellmembran och intracellulära membran. De utgörs av två typer, yttre perifera) och inre, integrerade, proteiner. De omfattar de flesta membranbundna enzymer, antigena proteiner, transportproteiner, och receptorer för läkemedel, hormoner och lektiner.
Mjälte: Ett organ i övre delen av bukhålan, rikt på blodkärl.
Molekylsekvensdata: Beskrivningar av specifika sekvenser av aminosyror, kolhydrater eller nukleotider som publicerats och/eller deponerats och hålls tillgängliga i databaser som t ex Genbank, EMBL, NBRF eller andra sekvensdataarkiv.
Molekylvikt: Summan av atomvikterna för de atomer som ingår i en molekyl. En modernare benämning är relativ molekylmassa.
Monoklonala antikroppar: Antikroppar som produceras av cellfamiljer kloner) av identiskt lika celler, framställda genom hybridisering av aktiverade B-lymfocyter och tumörceller. Sådana hybrider benämns ofta hybridom.
Möss, inavlade BALB C
Möss, inavlade C57BL
Möss, inavlade stammar: Genetiskt identiska individer framavlade genom syskonparning i tjugo eller fler generationer, eller genom parning mellan föräldrar och avkomma med vissa restriktioner. Alla djur inom en inavlad stam kan spåras tillbaka till en gemensam anfader till den tjugonde generationen.
Möss, nakna: Muterade möss som är homozygota för den recessiva “nakengenen” och inte utvecklar någon tymus bräss). De är värdefulla för tumörstudier och undersökning av immunsvar.
Neutralisationstester
Nötkreatur: Tamboskap som vanligtvis hålls på någon form av lantgård för produktion av kött eller mjölkprodukter eller som arbetsdjur.
Opsoninproteiner
Peptidbibliotek
Peptider
Peptidfragment
Polyakrylamidgelelektrofores: En typ av elektrofores där polyakrylamidgel används som diffusionsmedium.
Polymeraskedjereaktion
Polysackarider, bakteriella
Precipitintester
Proteinbindning
Proteinkonfiguration
Protozoiska antigener: Alla delar av någon protozo som kan framkalla immunitet. De vanligast förekommande är antigener från Plasmodium malaria) och trypanosomer.
Protozoiska antikroppar: Antikroppar producerade i människor och djur efter exponering för antigen från parasitiska protozoer.
Protozoproteiner
Radioimmunanalys
Radioimmundetektion
Radioimmunterapi
Rekombinanta fusionsproteiner
Rekombinanta proteiner
Reumatoid faktor
RNA, budbärar
Röda blodkroppar: Röda blodceller. Mogna blodkroppar saknar kärna, är formade som bikonkava skivor, och innehåller hemoglobin, vars funktion är att transportera syre. Syn. erytrocyter.
Sekvenshomologi, aminosyra
Sensitivitet och specificitet
Seroepidemiologiska studier
Serologiska tester
Single-Chain Antibodies
Single-Domain Antibodies
Sjukdomsmodeller, djur: Djursjukdommar vars kliniska mekanismer är tillräckligt lika dem hos annan sjukdom hos människor för att de skall kunna tjäna som modell. Sjukdomen hos djuret kan antingen vara framkallad eller naturlig.
Stelkrampstoxoid
Svampantikroppar: Immunglobuliner framkallade av antigena substanser hos svampar.
Svin: Alla djur som ingår i familjen Suidae, knubbiga, kortbenta och allätande däggdjur med tjock hud och borstliknande pälshår, förhållandevis lång nos och liten svans. Hit hör släktena Babyrousa, Phacochoerus vårtsvin) och Sus, till vilket hör det vanliga tamsvinet Sus scrofa).
Systemisk lupus erythematosus: En kronisk, återkommande, inflammatorisk och ofta febrig bindvävssjukdom som omfattar flera organsystem, huvudsakligen huden, lederna, njurarna och serösa hinnor. Orsaken är okänd, men man misstänker en brist i regleringen av det autoimmuna systemet. Sjukdomen kännetecknas av en rad systemiska funktionsbrister, förhöjd sänka och bildande av LE-celler i blod eller benmärg.
Tidsfaktorer
T-lymfocyter
Tumörantigener: Proteiner, glykoproteiner eller lipoproteinfraktioner på tumörcellers ytor, som vanligen kan identifieras med monoklonala antikroppar.Många av dessa har antingen embryonalt eller viralt ursprung.
Tumörantikroppar: Immunglobuliner framkallade av antigen specifika för tumörer. Hit hör inte normalt förekommande histokompatibilitetsantigen.
Tumörceller, odlade
Tumörcellinje
Utvärderingsstudier, principer: Studier för mätning av effektiviteten hos en process, personal och utrustning, eller material om genomförandet av sådana studier. När det gäller läkemedel och medicinska hjälpmedel finns termerna kliniska prövningar och
Vaccination
Vacciner, syntetiska
Variabel del av immunglobulin: Den del av immunglobulinmolekylen antikroppen), vars aminosyrasekvens och -sammansättning kan variera, som ger antikroppen dess antigenspecificitet och som antas utgöra bindningsplatsen för antigenet. Den återfinns vid Fab-fragmentets N-ände och omfattar såväl hypervariabla områden komplementära regioner) som ramområden.
Vävnadsdistribution
Virusantigener: Virusprodukter som har antigen effekt.
Virusantikroppar: Immunglobuliner producerade som svar på virala antigen; de omfattar alla klasser av immunglobuliner, framkallade av alla viruskomponenter.
Virushöljets proteiner
Virusproteiner
Virusvacciner
Ytantigener: Antigener på ytan av celler, inklusive infektionsframkallande celler, främmande celler eller virus. De utgörs vanligtvis av proteinhaltiga grupper, och kan vara isolerade, på cellmembran eller cellväg gar.

Safe-Green

Can Low-cost Indo Cyanine Green Florescence Technique for Sentinel Lymph Node Biopsy Replace Dual Dye (Radio-colloid and Blue Dye) Technique in Early Breast Cancer: A Prospective Two-arm Comparative Study.

The objective of this study was to assess the detection and accuracy of sentinel lymph node (SLN) biopsy (SLNB) using the low-cost indocyanine green (ICG) fluorescence method and to compare this method with the gold standard dual-dye method (radio-colloid + methylene blue dye [MB]).

One hundred patients with node-negative early breast cancer assessed clinically and by ultrasound axilla underwent an SLNB procedure using technetium-99m radio-colloid, MB, and ICG. The detection rate of SLNs and positive SLNs and the number of SLNs were compared. The injection safety of ICG and MB was evaluated.One hundred female patients with a median age of 52.3 years participated in the study.

Sixty-eight percent had a body mass index < 25, 85% presented with a palpable lump, of which 59% were in the outer quadrant. SLNs were identified in all 100 cases. A total of 290 SLNs were removed (mean, 2.9; range, 1-6). The identification rate with dual dye was 94%, whereas with ICG alone, it was 96%.

The SLNB sensitivity rate and false negative rate were 97.6% versus 93.2% and 3.1% versus 6.2% in the ICG and dual-dye combination, respectively. None of the patients had any local or systemic reaction with ICG; 3 patients with blue dye had tattooing and staining of skin.ICG fluorescence imaging permits real time visualization of lymphatics and provides an additional dimension to SLN biopsy that is safe and effective.

These results confirm high sensitivity for fluorescence localization with comparable performance to the gold standard. ICG can reliably replace dual dye and be employed as a sole tracer for SLNB in early breast cancer.

 

 

Safe-Red™

G108-R 1.0 ml
EUR 71

Safe-White™

G108-W 1.0 ml
EUR 71

Absolute Mag Protein A Magnetic Nanoparticles, Dextran Coated, 80 nm

WHM-G108 1 mL
EUR 746

Goat Immunoglobulin G (IgG) ELISA Kit

DLR-IgG-g-48T 48T
EUR 464
  • Should the Goat Immunoglobulin G (IgG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Goat Immunoglobulin G (IgG) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Immunoglobulin G (IgG) ELISA Kit

DLR-IgG-g-96T 96T
EUR 601
  • Should the Goat Immunoglobulin G (IgG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Goat Immunoglobulin G (IgG) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Immunoglobulin G (IgG) ELISA Kit

RDR-IgG-g-48Tests 48 Tests
EUR 482

Goat Immunoglobulin G (IgG) ELISA Kit

RDR-IgG-g-96Tests 96 Tests
EUR 667

Histamine [G-BSA] (G-G-BSA)

DAG3327 1mg
EUR 1234

Hepatitis Surface Antigen subtype Ayw Mutant G-145-R (HBsAg Ayw mutant), Recombinant (P. Pastoris), purified

HBA29-G-145R 50 ug
EUR 347

Cyclin G (Cyclin G) Antibody

20-abx013056
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cyclin G (Cyclin G) Antibody

abx232129-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Adipokinetic Hormone, G (AKH-G)

5-00610 4 x 5mg Ask for price

Nipah virus Glycoprotein G (G)

1-CSB-CF862323NDT
  • EUR 1454.00
  • EUR 728.00
  • EUR 984.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 72 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Nipah virus Glycoprotein G(G) expressed in in vitro E.coli expression system

Peptidylprolyl Isomerase G (Cyclophilin G) Antibody

20-abx114386
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

20-abx109883
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139500-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139501-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139502-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139503-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139504-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139505-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139506-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139507-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139508-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139510-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139511-01mg 0.1 mg
EUR 481
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139512-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

20-abx136098
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034899-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034900-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034900-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034168-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034168-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

20-abx009168
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

20-abx005635
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

20-abx320348
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endonuclease G, Mitochondrial (Endo G) Antibody

20-abx215156
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

20-abx215947
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Surface Glycoprotein G (G) Antibody

20-abx317831
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx413633-02mg 0.2 mg
EUR 648
  • Shipped within 1 week.

Leukocyte Antigen G (HLA-G) Antibody

abx413634-02mg 0.2 mg
EUR 648
  • Shipped within 1 week.

Protein Kinase G Substrate; G-Subtide

20-abx265631
  • EUR 439.00
  • EUR 718.00
  • EUR 328.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Adipokinetic Hormone, G (AKH-G) Peptide

20-abx266348
  • EUR 509.00
  • EUR 857.00
  • EUR 370.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

G-R-G-D-S-P

5-01166 4 x 5mg Ask for price

G-R-G-D-T-P

5-01167 4 x 5mg Ask for price

G-R-G-E-T-P

5-01169 4 x 5mg Ask for price

Protein Kinase G Substrate; G-Subtide

5-01842 4 x 5mg Ask for price

R-G-Y-S-L-G

5-01863 4 x 5mg Ask for price

Protein G

abx670070-5mg 5 mg
EUR 759
  • Shipped within 1 week.

Protein G

abx670076-1mg 1 mg
EUR 495
  • Shipped within 1 week.

Thiamet G

B2048-25 25 mg
EUR 350
Description: Thiamet G is a potent and selective inhibitor of O-GlcNAcase with Ki value of 21 nM [1].O-GlcNAcase is an enzyme that removes GlcNAc from proteins.

Thiamet G

B2048-5 5 mg
EUR 128
Description: Thiamet G is a potent and selective inhibitor of O-GlcNAcase with Ki value of 21 nM [1].O-GlcNAcase is an enzyme that removes GlcNAc from proteins.

Thiamet G

B2048-5.1 10 mM (in 1mL DMSO)
EUR 131
Description: Thiamet G is a potent and selective inhibitor of O-GlcNAcase with Ki value of 21 nM [1].O-GlcNAcase is an enzyme that removes GlcNAc from proteins.

G-749

B2213-1
EUR 131

G-749

B2213-5
EUR 349

G-36

B5707-10 10 mg
EUR 273

Antagonist G

B5243-1 1 mg
EUR 340

G-1

B5455-10 10 mg
EUR 273
Description: G-1 is a potent and selective agonist of GPR30 with EC50 value of 2 nM [1].G protein-coupled receptor 30 (GPR30) is an integral membrane protein that localizes to the endoplasmic reticulum and with high affinity for estradiol and aldosterone.

G-15

B5469-10 10 mg
EUR 273
Description: G-15 is a selective antagonist of GPR30 with Ki value of 20 nM [1].G protein-coupled receptor 30 (GPR30) is an integral membrane protein that localizes to the endoplasmic reticulum and with high affinity for estradiol and aldosterone.

Conantokin G

B5533-.5 500 ug
EUR 399

G-CSF

E21-002 10ug
EUR 343

G-1

HY-107216 10mg
EUR 360

G-5555

HY-19635 50mg
EUR 785

G-749

HY-12333 25mg
EUR 481

Thiamet G

HY-12588 50mg
EUR 601

Neuropeptide g

H-7455.0500 0.5mg
EUR 181
Description: Sum Formula: C99H158N34O29S; CAS# [114882-65-4] net

Neuropeptide g

H-7455.1000 1.0mg
EUR 300
Description: Sum Formula: C99H158N34O29S; CAS# [114882-65-4] net

g-Endorphin

H-2725.0001 1.0mg
EUR 151
Description: Sum Formula: C83H131N19O27S; CAS# [60893-02-9]

g-Endorphin

H-2725.0005 5.0mg
EUR 515
Description: Sum Formula: C83H131N19O27S; CAS# [60893-02-9]

Alisol G

HY-N0855 10mg
EUR 739

Gomisin G

HY-N0858 10mg
EUR 739

Tenacissoside G

HY-N2103 1mg
EUR 179

Hosenkoside G

HY-N2242 1mg
EUR 313

Rebaudioside G

HY-N2291 1mg
EUR 379

Saikosaponin G

HY-N4216 1mg
EUR 443

Kuwanon G

HY-N4247 10mg
EUR 436

Sulforhodamine g

80102 5G
EUR 165
Description: Minimum order quantity: 1 unit of 5G

G-749

A8889-1 1 mg
EUR 108
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.

G-749

A8889-5 5 mg
EUR 212
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.

G-749

A8889-5.1 10 mM (in 1mL DMSO)
EUR 422
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.

Antagonist G

5-00704 0.4 x 5mg Ask for price

Conantokin G

5-00989 4 x 1mg Ask for price

G-Q

5-01165 4 x 5mg Ask for price

W-G

5-02089 4 x 5mg Ask for price

Protein G

30C-CX4512 10 mg
EUR 456
Description: Immunoglobulin-binding bacterial Protein G solution

Protein G

6510-1
EUR 147

Protein G

6510-10
EUR 468

Protein G

6510-100
EUR 2328

Protein G

6510-1000
EUR 10321

Protein G

6510-5
EUR 283

Protein G

6510-5000 Ask for price

G Antibody

1-CSB-PA006050GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against G. Recognizes G from Human. This antibody is Unconjugated. Tested in the following application: ELISA

G Antibody

1-CSB-PA365937LA01HPO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against G. Recognizes G from Human respiRatory syncytial virus A. This antibody is Unconjugated. Tested in the following application: ELISA

G Antibody

1-CSB-PA389005LA01RIE
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against G. Recognizes G from Rabies virus. This antibody is Unconjugated. Tested in the following application: ELISA

G Antibody

1-CSB-PA14899A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against G. Recognizes G from Rabies virus. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Tenacissoside G

N2128-20 20 mg
EUR 282
Description: Extracted from Marsdenia tenacissima (Roxb.) Wight et Arn.;Store the product in sealed, cool and dry condition

Cathepsin G

MO20021 100 ul
EUR 213

pLTR- G

PVT11136 2 ug
EUR 266

G-CaMP3

PVT14629 2 ug
EUR 703

Alisol G

TA004029 10mg
EUR 570

Sophoraflavanone G

TB02920 10mg
EUR 228

Tenacissoside G

TB0420-0020 25mg
EUR 355

Gomisin G

TB0551-0020 10mg
EUR 355

Hosenkoside G

TB0882-0025 10mg
EUR 484

Negsehisandrin G

TB0907-0100 0.05ml
EUR 526

Rebaudioside G

TBW00142 10mg
EUR 484

Monnieriside G

TBW00193 5mg
EUR 634

Saikosaponin G

TBW00466 10mg
EUR 735

Erythrinin G

TBW00592 unit Ask for price

Leachianone G

TBW00594 unit Ask for price

Millewanin G

TBW00595 unit Ask for price

Buergerinin G

TBW00708 unit Ask for price

Mulberrofuran G

TBW00940 5mg Ask for price

Kalopanaxsaponin G

TBW01091 10mg Ask for price

Prosaikogenin G

TBW01602 unit Ask for price

Sarothralen G

TBZ0831 unit Ask for price

Yadanzioside G

TBZ1052 unit Ask for price

Budmunchiamine G

TBZ1131 unit Ask for price

Heteroclitin G

TBZ1388 unit Ask for price

Ixerin G

TBZ1500 unit Ask for price

Oleiferin G

TBZ1737 unit Ask for price

Senkyunolide G

TBZ1897 20mg Ask for price

Swietemahonin G

TBZ1935 unit Ask for price

Agrimol G

TBZ30073 unit Ask for price

Angulaturoid G

TBZ30107 unit Ask for price

C-Dots and composites based on them face the challenges of poor stability, especially under photo-radiation, and low solid-state photoluminescence quantum yields (PLQYs), which hinder their application in optical devices.

Herein, a novel 2-dimensional hybrid material of polysiloxane embedded with Si-doped carbon dots (P-E-Si-CDs) was synthesized by a self-assembly approach, and the hybrid composite exhibited broadband blue-green fluorescence emission, outstanding photostability, high thermal stability, and a high PLQY of 82.8%.

Moreover, the dual fluorescent emissions were demonstrated the creation of two closed-loop fluorophores.

Using the as-prepared hybrid fluorescent material, fabricated light-emitting diodes (LEDs) based on UV and blue-emitting LED chips present safe warm white light emission and adjustable white emission with a high color rendering index of up to 91, respectively.

This work provides a novel strategy for the design and realization of Si-CD-based hybrid composites, thus promising their prospective use commercially in LED lighting.

VDAC2

VDAC2 antibody
70R-21248 50 ul
EUR 435
Description: Rabbit polyclonal VDAC2 antibody
VDAC2 Antibody
47453-100ul 100ul
EUR 252
VDAC2 Antibody
1-CSB-PA025824GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
VDAC2 Antibody
1-CSB-PA025824LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
VDAC2 antibody
70R-5052 50 ug
EUR 467
Description: Rabbit polyclonal VDAC2 antibody raised against the N terminal of VDAC2
VDAC2 antibody
70R-5053 50 ug
EUR 467
Description: Rabbit polyclonal VDAC2 antibody raised against the N terminal of VDAC2
VDAC2 Antibody
AF5397 200ul
EUR 304
Description: VDAC2 antibody detects endogenous levels of total VDAC2.
VDAC2 siRNA
20-abx906016
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC2 siRNA
20-abx939380
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC2 siRNA
20-abx939381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC2 antibody
ABF5397 100 ug
EUR 438
VDAC2 Blocking Peptide
33R-5772 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC2 antibody, catalog no. 70R-5053
VDAC2 Blocking Peptide
33R-9629 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC2 antibody, catalog no. 70R-5052
VDAC2 Blocking Peptide
AF5397-BP 1mg
EUR 195
VDAC2 Conjugated Antibody
C47453 100ul
EUR 397
VDAC2 cloning plasmid
CSB-CL025824HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgtgtattcctccatcatatgctgaccttggcaaagctgccagagatattttcaacaaaggatttggttttgggttggtgaaactggatgtgaaaacaaagtcttgcagtggcgtggaattttcaacgtccggttcatctaatacagacactggtaaagttactgggaccttgga
  • Show more
Description: A cloning plasmid for the VDAC2 gene.
VDAC2 cloning plasmid
CSB-CL025824HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atggcgacccacggacagacttgcgcgcgtccaatgtgtattcctccatcatatgctgaccttggcaaagctgccagagatattttcaacaaaggatttggttttgggttggtgaaactggatgtgaaaacaaagtcttgcagtggcgtggaattttcaacgtccggttcatctaa
  • Show more
Description: A cloning plasmid for the VDAC2 gene.
anti- VDAC2 antibody
FNab09386 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: voltage-dependent anion channel 2
  • Uniprot ID: P45880
  • Gene ID: 7417
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC2
anti- VDAC2 antibody
FNab09387 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: voltage-dependent anion channel 2
  • Uniprot ID: P45880
  • Gene ID: 7417
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC2
Anti-VDAC2 antibody
PAab09386 100 ug
EUR 386
pCMV-SPORT6-VDAC2
PVT13664 2 ug
EUR 391
Anti-VDAC2 (3D2)
YF-MA16052 100 ug
EUR 363
Description: Mouse monoclonal to VDAC2
VDAC2 Antibody, HRP conjugated
1-CSB-PA025824LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
VDAC2 Antibody, FITC conjugated
1-CSB-PA025824LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
VDAC2 Antibody, Biotin conjugated
1-CSB-PA025824LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
VDAC2 ELISA KIT|Human
EF004186 96 Tests
EUR 689
Mouse Vdac2 ELISA KIT
ELI-51179m 96 Tests
EUR 865
Human VDAC2 ELISA KIT
ELI-44613h 96 Tests
EUR 824
Mouse VDAC2 shRNA Plasmid
20-abx973356
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat VDAC2 shRNA Plasmid
20-abx986790
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human VDAC2 shRNA Plasmid
20-abx955075
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine VDAC2 ELISA KIT
ELI-39848b 96 Tests
EUR 928
VDAC2 Recombinant Protein (Rat)
RP236339 100 ug Ask for price
VDAC2 Recombinant Protein (Human)
RP034294 100 ug Ask for price
VDAC2 Recombinant Protein (Human)
RP034297 100 ug Ask for price
VDAC2 Recombinant Protein (Mouse)
RP183725 100 ug Ask for price
Anti-VDAC2 (Internal) antibody
STJ70995 100 µg
EUR 359
Polyclonal VDAC2 Antibody (C-Terminus)
APR10706G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VDAC2 (C-Terminus). This antibody is tested and proven to work in the following applications:
Vdac2 ORF Vector (Mouse) (pORF)
ORF061243 1.0 ug DNA
EUR 506
Vdac2 ORF Vector (Rat) (pORF)
ORF078781 1.0 ug DNA
EUR 506
VDAC2 ORF Vector (Human) (pORF)
ORF011432 1.0 ug DNA
EUR 95
VDAC2 ORF Vector (Human) (pORF)
ORF011433 1.0 ug DNA
EUR 95
Anti-VDAC2 (C Terminus) antibody
STJ70527 100 µg
EUR 359
Polyclonal Goat Anti-VDAC2 (Internal) Antibody
AMM05156G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VDAC2 (Internal) . This antibody is tested and proven to work in the following applications:
Vdac2 sgRNA CRISPR Lentivector set (Rat)
K7622101 3 x 1.0 ug
EUR 339
VDAC2 sgRNA CRISPR Lentivector set (Human)
K2608401 3 x 1.0 ug
EUR 339
Vdac2 sgRNA CRISPR Lentivector set (Mouse)
K4573601 3 x 1.0 ug
EUR 339
Monoclonal VDAC2 Antibody (monoclonal) (M01), Clone: 3D2
APR10707G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human VDAC2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3D2. This antibody is applicable in WB and IF, E
Voltage-Dependent Anion Channel 2 (VDAC2) Antibody
20-abx116629
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Polyclonal Goat Anti-VDAC2 (C Terminus) Antibody
AMM05155G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VDAC2 (C Terminus) . This antibody is tested and proven to work in the following applications:
Vdac2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7622102 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7622103 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7622104 1.0 ug DNA
EUR 154
VDAC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2608402 1.0 ug DNA
EUR 154
VDAC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2608403 1.0 ug DNA
EUR 154
VDAC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2608404 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4573602 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4573603 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4573604 1.0 ug DNA
EUR 154
VDAC2 Protein Vector (Mouse) (pPB-C-His)
PV244970 500 ng
EUR 603
VDAC2 Protein Vector (Mouse) (pPB-N-His)
PV244971 500 ng
EUR 603
VDAC2 Protein Vector (Mouse) (pPM-C-HA)
PV244972 500 ng
EUR 603
VDAC2 Protein Vector (Mouse) (pPM-C-His)
PV244973 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPB-C-His)
PV315122 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPB-N-His)
PV315123 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPM-C-HA)
PV315124 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPM-C-His)
PV315125 500 ng
EUR 603
VDAC2 Protein Vector (Human) (pPB-C-His)
PV045725 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPB-N-His)
PV045726 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-HA)
PV045727 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-His)
PV045728 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPB-C-His)
PV045729 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPB-N-His)
PV045730 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-HA)
PV045731 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-His)
PV045732 500 ng
EUR 329

UBA52

Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) ELISA Kit
DLR-UBA52-Hu-96T 96T
EUR 673
  • Should the Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) in samples from tissue homogenates or other biological fluids.
Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) ELISA Kit
RDR-UBA52-Hu-48Tests 48 Tests
EUR 544
Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) ELISA Kit
RDR-UBA52-Hu-96Tests 96 Tests
EUR 756
Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) ELISA Kit
RD-UBA52-Hu-48Tests 48 Tests
EUR 521
Human Ubiquitin A 52 Residue Ribosomal Protein Fusion Product 1 (UBA52) ELISA Kit
RD-UBA52-Hu-96Tests 96 Tests
EUR 723
Uba52/ Rat Uba52 ELISA Kit
ELI-41132r 96 Tests
EUR 886
UBA52 siRNA
20-abx905896
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBA52 siRNA
20-abx938721
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBA52 siRNA
20-abx938722
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBA52 antibody
70R-21087 50 ul
EUR 435
Description: Rabbit polyclonal UBA52 antibody
UBA52 Antibody
ABD8021 100 ug
EUR 438
UBA52 Antibody
ABD8071 100 ug
EUR 438
UBA52 Antibody
43827-100ul 100ul
EUR 252
UBA52 Antibody
DF8021 200ul
EUR 304
Description: UBA52 Antibody detects endogenous levels of total UBA52.
UBA52 Antibody
CSB-PA035362-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
UBA52 Antibody
CSB-PA035362-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
UBA52 Antibody
1-CSB-PA060035
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000
UBA52 Antibody
1-CSB-PA025416GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
UBA52 Antibody
1-CSB-PA025416LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
UBA52 Conjugated Antibody
C43827 100ul
EUR 397
anti- UBA52 antibody
FNab09145 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: ubiquitin A-52 residue ribosomal protein fusion product 1
  • Uniprot ID: P62987
  • Gene ID: 7311
  • Research Area: Immunology, Metabolism
Description: Antibody raised against UBA52
UBA52 Rabbit pAb
A16713-100ul 100 ul
EUR 308
UBA52 Rabbit pAb
A16713-200ul 200 ul
EUR 459
UBA52 Rabbit pAb
A16713-20ul 20 ul
EUR 183
UBA52 Rabbit pAb
A16713-50ul 50 ul
EUR 223
UBA52 Blocking Peptide
DF8021-BP 1mg
EUR 195
Anti-UBA52 antibody
PAab09145 100 ug
EUR 386
Anti-UBA52 antibody
STJ119135 100 µl
EUR 277
anti-Anti-UBA52
YF-PA24923 50 ul
EUR 334
Description: Mouse polyclonal to Anti-UBA52
Rat UBA52 shRNA Plasmid
20-abx986163
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine UBA52 ELISA KIT
ELI-14494d 96 Tests
EUR 928
UBA52 ELISA KIT|Human
EF007238 96 Tests
EUR 689
Human UBA52 shRNA Plasmid
20-abx954998
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UBA52 shRNA Plasmid
20-abx973278
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBA52 Antibody, HRP conjugated
1-CSB-PA025416LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBA52 Antibody, FITC conjugated
1-CSB-PA025416LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBA52 Antibody, Biotin conjugated
1-CSB-PA025416LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA52. Recognizes UBA52 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
UBA52 Recombinant Protein (Human)
RP106097 100 ug Ask for price
UBA52 Recombinant Protein (Rat)
RP235481 100 ug Ask for price
UBA52 Recombinant Protein (Mouse)
RP182552 100 ug Ask for price
Polyclonal UBA52 Antibody (C-Term)
APR13896G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBA52 (C-Term). This antibody is tested and proven to work in the following applications:
UBB / UBC / RPS27A / UBA52 Antibody
20-abx326873
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327342
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327433
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327720
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBB / UBC / RPS27A / UBA52 Antibody
20-abx328678
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBB/UBC/RPS27A/UBA52 Antibody
1-CSB-PA004354
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBB/UBC/RPS27A/UBA52. Recognizes UBB/UBC/RPS27A/UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA005763
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA005933
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA006103
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
UBB/UBC/RPS27A/UBA52 Antibody
1-CSB-PA374539
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against UBB/UBC/RPS27A/UBA52. Recognizes UBB/UBC/RPS27A/UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000
UBA52 ORF Vector (Human) (pORF)
ORF035367 1.0 ug DNA
EUR 405
Uba52 ORF Vector (Rat) (pORF)
ORF078495 1.0 ug DNA
EUR 506
Uba52 ORF Vector (Mouse) (pORF)
ORF060852 1.0 ug DNA
EUR 506
UBA52 ELISA Kit (Human) (OKCD01827)
OKCD01827 96 Wells
EUR 831
Description: Description of target: Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling. 60S ribosomal protein L40: Component of the 60S subunit of the ribosome. Ribosomal protein L40 is essential for translation of a subset of cellular transcripts, and especially for cap-dependent translation of vesicular stomatitis virus mRNAs. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL
UBA52 sgRNA CRISPR Lentivector set (Human)
K2567801 3 x 1.0 ug
EUR 339
Uba52 sgRNA CRISPR Lentivector set (Mouse)
K3977501 3 x 1.0 ug
EUR 339
Uba52 sgRNA CRISPR Lentivector set (Rat)
K6988801 3 x 1.0 ug
EUR 339
Acetyl-UBA52 / RPS27A / UBB / UBC (K27) Antibody
20-abx327497
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acetyl-UBA52 / RPS27A / UBB / UBC (K29) Antibody
20-abx327498
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acetyl-UBA52 / RPS27A / UBB / UBC (K33) Antibody
20-abx327499
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acetyl-UBA52 / RPS27A / UBB / UBC (K48) Antibody
20-abx327500
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 sgRNA CRISPR Lentivector (Human) (Target 1)
K2567802 1.0 ug DNA
EUR 154
UBA52 sgRNA CRISPR Lentivector (Human) (Target 2)
K2567803 1.0 ug DNA
EUR 154
UBA52 sgRNA CRISPR Lentivector (Human) (Target 3)
K2567804 1.0 ug DNA
EUR 154
Acetyl-UBA52/RPS27A/UBB/UBC (K27) Antibody
1-CSB-PA000137
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K27). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K27) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52/RPS27A/UBB/UBC (K29) Antibody
1-CSB-PA000143
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K29). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K29) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52/RPS27A/UBB/UBC (K33) Antibody
1-CSB-PA000144
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K33). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K33) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-UBA52/RPS27A/UBB/UBC (K48) Antibody
1-CSB-PA000145
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-UBA52/RPS27A/UBB/UBC (K48). Recognizes Acetyl-UBA52/RPS27A/UBB/UBC (K48) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Uba52 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3977502 1.0 ug DNA
EUR 154
Uba52 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3977503 1.0 ug DNA
EUR 154
Uba52 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3977504 1.0 ug DNA
EUR 154
Uba52 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6988802 1.0 ug DNA
EUR 154
Uba52 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6988803 1.0 ug DNA
EUR 154
Uba52 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6988804 1.0 ug DNA
EUR 154

UBE2H

UBE2H Antibody
1-CSB-PA025455GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2H. Recognizes UBE2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
UBE2H siRNA
20-abx938780
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2H siRNA
20-abx938781
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2H Polyclonal Antibody
30894-100ul 100ul
EUR 252
UBE2H Polyclonal Antibody
30894-50ul 50ul
EUR 187
Human Ube2H Antibody
33310-05111 150 ug
EUR 261
UBE2H cloning plasmid
CSB-CL025455HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 552
  • Sequence: atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctga
  • Show more
Description: A cloning plasmid for the UBE2H gene.
UBE2H Rabbit pAb
A7344-100ul 100 ul
EUR 308
UBE2H Rabbit pAb
A7344-200ul 200 ul
EUR 459
UBE2H Rabbit pAb
A7344-20ul 20 ul
EUR 183
UBE2H Rabbit pAb
A7344-50ul 50 ul
EUR 223
UBE2H Polyclonal Antibody
ABP60820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein
UBE2H Polyclonal Antibody
ABP60820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein
UBE2H Polyclonal Antibody
ABP60820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein
anti- UBE2H antibody
FNab09176 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin-conjugating enzyme E2H
  • Uniprot ID: P62256
  • Gene ID: 7328
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2H
UBE2H Polyclonal Antibody
ES10438-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBE2H from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
UBE2H Polyclonal Antibody
ES10438-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2H from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-UBE2H antibody
PAab09176 100 ug
EUR 386
Anti-UBE2H antibody
STJ29483 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms.
Anti-UBE2H antibody
STJ191596 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2H
UBE2H protein (His tag)
80R-2249 100 ug
EUR 322
Description: Purified recombinant Human UBE2H Protein (His tag)
UBE2H ELISA KIT|Human
EF004004 96 Tests
EUR 689
Mouse UBE2H shRNA Plasmid
20-abx973292
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2H Polyclonal Conjugated Antibody
C30894 100ul
EUR 397
Human UBE2H shRNA Plasmid
20-abx955011
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti-UBE2H (3C4-1A2)
LF-MA10365 100 ug
EUR 363
Description: Mouse monoclonal to UBE2H
UBE2H Recombinant Protein (Rat)
RP235556 100 ug Ask for price
UBE2H Recombinant Protein (Human)
RP033706 100 ug Ask for price
UBE2H Recombinant Protein (Mouse)
RP182654 100 ug Ask for price
UBE2H Recombinant Protein (Mouse)
RP182657 100 ug Ask for price
UBE2H Recombinant Protein (Mouse)
RP182660 100 ug Ask for price
Human Ube2H Antibody (Biotin Conjugate)
33310-05121 150 ug
EUR 369
Ube2h ORF Vector (Rat) (pORF)
ORF078520 1.0 ug DNA
EUR 506
UBE2H ORF Vector (Human) (pORF)
ORF011236 1.0 ug DNA
EUR 95
Ube2h ORF Vector (Mouse) (pORF)
ORF060886 1.0 ug DNA
EUR 506
Ube2h ORF Vector (Mouse) (pORF)
ORF060887 1.0 ug DNA
EUR 506
Ube2h ORF Vector (Mouse) (pORF)
ORF060888 1.0 ug DNA
EUR 506
Human Ube2H AssayLite Antibody (FITC Conjugate)
33310-05141 150 ug
EUR 428
Human Ube2H AssayLite Antibody (RPE Conjugate)
33310-05151 150 ug
EUR 428
Human Ube2H AssayLite Antibody (APC Conjugate)
33310-05161 150 ug
EUR 428
Human Ube2H AssayLite Antibody (PerCP Conjugate)
33310-05171 150 ug
EUR 471
Polyclonal Ube2h Antibody - N-terminal region
APR00871G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ube2h - N-terminal region. This antibody is tested and proven to work in the following applications:
Ube2h sgRNA CRISPR Lentivector set (Rat)
K6090601 3 x 1.0 ug
EUR 339
UBE2H sgRNA CRISPR Lentivector set (Human)
K2572101 3 x 1.0 ug
EUR 339
Ube2h sgRNA CRISPR Lentivector set (Mouse)
K4746401 3 x 1.0 ug
EUR 339
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
20-abx006923
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (ube2h) Antibody
20-abx116469
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
20-abx142292
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
abx029157-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
abx029157-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
abx239176-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ube2h sgRNA CRISPR Lentivector (Rat) (Target 1)
K6090602 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Rat) (Target 2)
K6090603 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Rat) (Target 3)
K6090604 1.0 ug DNA
EUR 154
UBE2H sgRNA CRISPR Lentivector (Human) (Target 1)
K2572102 1.0 ug DNA
EUR 154
UBE2H sgRNA CRISPR Lentivector (Human) (Target 2)
K2572103 1.0 ug DNA
EUR 154
UBE2H sgRNA CRISPR Lentivector (Human) (Target 3)
K2572104 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4746402 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4746403 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4746404 1.0 ug DNA
EUR 154
UBE2H Protein Vector (Mouse) (pPB-C-His)
PV243542 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-N-His)
PV243543 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-HA)
PV243544 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-His)
PV243545 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-C-His)
PV243546 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-N-His)
PV243547