TMB Solution (500 mL Part A & 500 mL Part B)

This is a predefined sub-study of the Endothelial Dysfunction in Resuscitated Cardiac Arrest (ENDO-RCA) trial.

We aim to investigate Iloprost, a prostacyclin analogue, safety by evaluating change in whole blood platelet aggregometry (Multiplate) in out of hospital cardiac arrest (OHCA) patients from baseline to 96-h post randomization.A randomized, placebo controlled double-blinded trial in 46 OHCA patients. Patients were allocated 1:2 to 48 h Iloprost infusion, (1 ng/kg/min) or placebo (saline infusion). Platelet aggregation was determined by platelet aggregation tests ASPI-test (arachidonic acid); TRAP-test (thrombin-receptor activating peptide (TRAP)-6; RISTO test (Ristocetin); ADP test (adenosin diphosphat).

There was no significant difference between the iloprost and placebo groups according to ASPI, TRAP, RISTO and ADP platelet aggregation assays. Further, no significant differences regarding risk of bleeding were found between groups (Risk of bleeding: ASPI <40 U; TRAP <92 U; RISTO <35 U; ADP <50 U).

In conclusion, the iloprost infusion did not influence platelet aggregation as evaluated by the ASPI, TRAP, RISTO and ADP assays. There was no increased risk of bleeding or transfusion therapy. A decline in platelet aggregation was observed for the ASPI and ADP assays during the initial 96 h after OHCA.Trial registration at clinicaltrials.gov (identifier NCT02685618) on 18-02-2016.

HO-PEG-PCL(2K),2K

HE002059-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-COOH,2K

HE084017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-Ph,2K

HE084081-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-FITC,2K

FL001044-2K-100mg 100mg
EUR 383
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DBCO,2K

MF001048-2K-100mg 100mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-OH,2K

HO002002-2K-10g 10g
EUR 283
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Benhz-PEG-Benhz,2K

HO070070-2K-1g 1g
EUR 306
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SH-PEG-HZ,2K

HE003019-2K-1g1050 1g1050
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NH2-PEG-DBCO, 2K

HE005048-2K-500G 500G
EUR 1110
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NH2-PEG-Galactose,2K

HE005072-2K-1g 1g
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

ACRL-PEG-RGD,2K

HE009074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-FA,2K

HE041057-2K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-SH,2K

HE048003-2K-100mg 100mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-Mal,2K

HE048022-2K-100mg 100mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-NHS,2K

HE048023-2K-100mg 100mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-SH,2K

HE057003-2K-100mg 100mg
EUR 371
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-ALD,2K

HE057004-2K-100mg 100mg
EUR 403
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-Alkyne,2K

HE057007-2K-100mg 100mg
EUR 416
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-COOH,2K

HE057017-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-NHS,2K

HE057023-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-NH2,2K

HE084005-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-OH,2K

FL044002-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-SH,2K

FL044003-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-Alkyne,2K

FL044007-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-COOH,2K

FL044017-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-MAL,2K

FL044022-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-NHS,2K

FL044023-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-FITC,2K

FL044041-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-FA,2K

FL044057-2K-100mg 100mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-Azithromycin,2K

FL044076-2K-100mg 100mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-OH,2K

FL045002-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-SH,2K

FL045003-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-COOH,2K

FL045017-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-Mal,2K

FL045022-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-NHS,2K

FL045023-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-Biotin,2K

FL045041-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-DSPE,2K

FL045096-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-OH,2K

FL077002-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-SH,2K

FL077003-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-COOH,2K

FL077017-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-Mal,2K

FL077022-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-NHS,2K

FL077023-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-Biotin,2K

FL077041-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-SH,2K

FL078003-2K-50mg 50mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-COOH,2K

FL078017-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-Mal,2K

FL078022-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY5.5-PEG-SH,2K

FL079003-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY5.5-PEG-FA,2k

FL079057-2K-100mg 100mg
EUR 790
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY7-PEG-DSPE?2K

FL080096-2K-50mg 50mg
EUR 494
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-FITC,2K

FL096044-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS-C30, 2K

MF001092-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cholesterol-PEG-Mal,2K

LP095022-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cholesterol-PEG-Biotin,2K

LP095041-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CLS-PEG-FITCl,2K

LP095044-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-CLS,2K

LP095057-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Alkyne-PEG-DSPE,2K

LP096007-2K-g g
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Dopamine, 2K

LP096047-2K-100mg 100mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Galactose,2K

LP096072-2K-1g 1g
EUR 852
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-RGD,2K

LP096074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-RVG,2K

LP096094-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Monostearate-PEG-COOH,2K

LP101017-2K-g g
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(12K)-PEG-Mal,2K

HE062022-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(1.8K)-PEG-COOH,2K

HE083017-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-COOH,2K

HE085017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-MAL,2K

HE085022-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-NHS,2K

HE085023-2K-500mg 500mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(5K)-PEG-Galactose, 2K

HE116072-2K-G G
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-SP2-AA,2K

LP096105-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(50:50)?8K?-PEG-Mal,2K

HE086022-2K-500mg 500mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

2K antibody

10R-7771 500 ug
EUR 565
Description: Mouse monoclonal 2K antibody

2K DNA Marker

20-abx098045
  • EUR 258.00
  • EUR 189.00
  • 2.5 ml
  • 500 ul
  • Shipped within 5-10 working days.

mPEG-OH,2K

33-MF001002-2K
  • EUR 235.00
  • EUR 482.00
  • 10g
  • 50g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SH,2K

33-MF001003-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-CHO,2K

33-MF001004-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AlKyne,2K

33-MF001007-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Alkyene,2K

33-MF001008-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AC,2K

33-MF001009-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-ACA,2K

33-MF001010-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MA,2K

33-MF001011-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GA,2K

33-MF001012-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SA,2K

33-MF001013-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GAA,2K

33-MF001014-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SAA,2K

33-MF001015-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-PA,2K

33-MF001016-2K
  • EUR 494.00
  • EUR 198.00
  • 5G
  • G
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-COOH?2K

33-MF001017-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-IA,2K

33-MF001018-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Hydrazide,2K

33-MF001019-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Silane,2K

33-MF001020-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Epoxide,2K

33-MF001021-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,2K

33-MF001022-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SC,2K

33-MF001023-2K
  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SCM,2K

33-MF001024-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SPA,2K

33-MF001025-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SG,2K

33-MF001027-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS,2K

33-MF001028-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GAS,2K

33-MF001029-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SAS,2K

33-MF001030-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-NPC,2K

33-MF001034-2K
  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-OPSS,2K

33-MF001035-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Ts,2K

33-MF001038-2K
  • EUR 100.00
  • EUR 198.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-LA,2K

33-MF001039-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Biotin,2K

33-MF001041-2K
  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Dansyl,2K

33-MF001046-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Dopamine,2K

33-MF001047-2K
  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DF,2K

33-MF001051-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Br,2K

33-MF001056-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-FA,2K

33-MF001057-2K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-CLS,2K

33-MF001095-2K
  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DSPE,2K

33-MF001096-2K
  • EUR 211.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DMPE,2K

33-MF001097-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DPPE,2K

33-MF001098-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DLPE,2K

33-MF001099-2K
  • EUR 285.00
  • EUR 753.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AA,2K

33-MF001121-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DOPE,2k

33-LP001100-2K
  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SH-PEG-SH,2K

33-HO003003-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CHO-PEG-CHO,2K

33-HO004004-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AlKyne-PEG-AlKyne,2K

33-HO007007-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Alkyene-PEG-Alkyene,2K

33-HO008008-2K
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AC-PEG-AC,2K

33-HO009009-2K
  • EUR 167.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

ACA-PEG-ACA,2K

33-HO010010-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MA-PEG-MA,2K

33-HO011011-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GA-PEG-GA,2K

33-HO012012-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SA-PEG-SA,2K

33-HO013013-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GAA-PEG-GAA,2K

33-HO014014-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SAA-PEG-SAA,2K

33-HO015015-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PA-PEG-PA,2K

33-HO016016-2K
  • EUR 190.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

COOH-PEG-COOH,2K

33-HO017017-2K
  • EUR 143.00
  • EUR 422.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

IA-PEG-IA,2K

33-HO018018-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

HZ-PEG-HZ,2K

33-HO019019-2K
  • EUR 201.00
  • EUR 503.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Epoxide-PEG-Epoxide,2K

33-HO021021-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,2K

33-HO022022-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SC-PEG-SC,2K

33-HO023023-2K
  • EUR 143.00
  • EUR 329.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SCM-PEG-SCM,2K

33-HO024024-2K
  • EUR 167.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SPA-PEG-SPA,2K

33-HO025025-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SG-PEG-SG,2K

33-HO027027-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SS-PEG-SS,2K

33-HO028028-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GAS-PEG-GAS,2K

33-HO029029-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SAS-PEG-SAS,2K

33-HO030030-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NPC-PEG-NPC,2K

33-HO034034-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OPSS-PEG-OPSS,2K

33-HO035035-2K
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Tos-PEG-Tos,2k

33-HO038038-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-Biotin,2K

33-HO041041-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-DBCO,2K

33-HO048048-2K
  • EUR 422.00
  • EUR 1083.00
  • 100mg
  • 500mg
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DF-PEG-DF,2K

33-HO051051-2K
  • EUR 375.00
  • EUR 1025.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Br-PEG-Br,2K

33-HO056056-2K
  • EUR 201.00
  • EUR 503.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-DSPE,2K

33-HO096096-2K
  • EUR 491.00
  • EUR 1373.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AA-PEG-AA, 2k

33-HO121121-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-NHS,2K

33-HE002023-2K
  • EUR 322.00
  • EUR 864.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-SCM,2K

33-HE002024-2K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

HO-PEG-AA. 2K

33-HE002121-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

 

Platelet function testing is a cornerstone in the diagnostic investigation of patients with a bleeding history. Multiple electrode aggregometry (MEA) has been shown to detect von Willebrand disease (VWD), platelet function disorders, and drug-induced bleeding disorders. However, there are few studies supporting its successful use in children. We have implemented and used MEA over 3 years in our hemostasis laboratory in order to study its usefulness to supplement and expedite diagnosis.

This is a retrospective, single-center, cohort study of 109 hospitalized children who underwent a laboratory investigation of hemostasis and either had a reported bleeding history or an abnormal bleeding episode.

Plasmatic coagulation testing, blood counts, plasmatic von Willebrand testing, platelet function analyzer (PFA-100), and impedance aggregometry (MEA) were performed in all children. Light transmission aggregometry testing was performed as needed.

In 41 cases (37.6%), a working diagnosis was made; a primary hemostatic disorder was detected in 35 children (VWD (n = 16), platelet disorder (n = 15), and valproic acid therapy-induced bleeding disorder (n = 3), acetylsalicylic acid-related bleeding (n = 1). In patients diagnosed with VWD, MEA ristocetin-induced platelet aggregation test (RISTO) high test revealed abnormally low aggregation in six patients (43.8%); whereas in patients diagnosed with a platelet function disorder, abnormally low values were found by MEA in only three children (20%).

Three of the four children with laboratory evidence of drug-induced platelet dysfunction had abnormalities on MEA.

There were no cases in which an abnormal MEA result was used to make a previously undetermined diagnosis. Retrospectively, MEA has demonstrated limited additional diagnostic value beyond standard laboratory testing for detecting defects of primary hemostasis in children.

PSMD14

PSMD14 Antibody

31120-50ul 50ul
EUR 187

PSMD14 antibody

70R-19600 50 ul
EUR 435
Description: Rabbit polyclonal PSMD14 antibody

PSMD14 Antibody

1-CSB-PA644570
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PSMD14 Antibody

1-CSB-PA967586
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PSMD14 Antibody

DF8011 200ul
EUR 304
Description: PSMD14 Antibody detects endogenous levels of total PSMD14.

PSMD14 Antibody

1-CSB-PA018904GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMD14 Antibody

1-CSB-PA018904OA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PSMD14 siRNA

20-abx930182
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD14 siRNA

20-abx930183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD14 Antibody

ABD8011 100 ug
EUR 438

PSMD14 Antibody

ABD8036 100 ug
EUR 438

anti-PSMD14

YF-PA16792 50 ul
EUR 363
Description: Mouse polyclonal to PSMD14

anti-PSMD14

YF-PA16793 50 ug
EUR 363
Description: Mouse polyclonal to PSMD14

anti-PSMD14

YF-PA25513 50 ul
EUR 334
Description: Mouse polyclonal to PSMD14

PSMD14 Rabbit pAb

A10782-100ul 100 ul
EUR 308

PSMD14 Rabbit pAb

A10782-200ul 200 ul
EUR 459

PSMD14 Rabbit pAb

A10782-20ul 20 ul
EUR 183

PSMD14 Rabbit pAb

A10782-50ul 50 ul
EUR 223

PSMD14 Blocking Peptide

DF8011-BP 1mg
EUR 195

PSMD14 Conjugated Antibody

C31120 100ul
EUR 397

PSMD14 cloning plasmid

CSB-CL018904HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atgttgctaaatttgcataagaagagttggatggaaggtttgacacttcaggactacagtgaacattgtaaacacaatgaatcagtggtaaaagagatgttggaattagccaagaattacaataaggctgtagaagaagaagataagatgacacctgaacagctggcaataaagaa
  • Show more
Description: A cloning plasmid for the PSMD14 gene.

PSMD14 cloning plasmid

CSB-CL018904HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atggacagacttcttagacttggaggaggtatgcctggactgggccaggggccacctacagatgctcctgcagtggacacagcagaacaagtctatatctcttccctggcactgttaaaaatgttaaaacatggccgtgctggagttccaatggaagttatgggtttgatgcttgg
  • Show more
Description: A cloning plasmid for the PSMD14 gene.

anti- PSMD14 antibody

FNab06886 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: proteasome(prosome, macropain) 26S subunit, non-ATPase, 14
  • Uniprot ID: O00487
  • Gene ID: 10213
  • Research Area: Metabolism
Description: Antibody raised against PSMD14

Anti-PSMD14 antibody

PAab06886 100 ug
EUR 412

pCMV-SPORT6-PSMD14

PVT13244 2 ug
EUR 391

Anti-PSMD14 antibody

STJ112678 100 µl
EUR 277
Description: This gene encodes a component of the 26S proteasome. The 26S proteasome is a large multiprotein complex that catalyzes the degradation of ubiquitinated intracellular proteins. The encoded protein is a component of the 19S regulatory cap complex of the 26S proteasome and mediates substrate deubiquitination. A pseudogene of this gene is also located on the long arm of chromosome 2.

Human PSMD14 ELISA KIT

ELI-30564h 96 Tests
EUR 824

PSMD14 ELISA KIT|Human

EF002129 96 Tests
EUR 689

Mouse Psmd14 ELISA KIT

ELI-52405m 96 Tests
EUR 865

Mouse PSMD14 shRNA Plasmid

20-abx975155
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD14 Antibody, HRP conjugated

1-CSB-PA018904OB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMD14 Antibody, FITC conjugated

1-CSB-PA018904OC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMD14 Antibody, Biotin conjugated

1-CSB-PA018904OD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMD14 shRNA Plasmid

20-abx956902
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD14 Recombinant Protein (Human)

RP024982 100 ug Ask for price

PSMD14 Recombinant Protein (Human)

RP024985 100 ug Ask for price

PSMD14 Recombinant Protein (Mouse)

RP165332 100 ug Ask for price

PSMD14 Recombinant Protein (Rat)

RP222671 100 ug Ask for price

Anti-PSMD14 (4A10-E8)

YF-MA17193 100 ug
EUR 363
Description: Mouse monoclonal to PSMD14

Polyclonal PSMD14 Antibody (C-term)

APR04410G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD14 (C-term). This antibody is tested and proven to work in the following applications:

Psmd14 ORF Vector (Rat) (pORF)

ORF074225 1.0 ug DNA
EUR 506

PSMD14 ORF Vector (Human) (pORF)

ORF008328 1.0 ug DNA
EUR 95

PSMD14 ORF Vector (Human) (pORF)

ORF008329 1.0 ug DNA
EUR 95

Psmd14 ORF Vector (Mouse) (pORF)

ORF055112 1.0 ug DNA
EUR 506

Psmd14 sgRNA CRISPR Lentivector set (Mouse)

K4926501 3 x 1.0 ug
EUR 339

Psmd14 sgRNA CRISPR Lentivector set (Rat)

K7188001 3 x 1.0 ug
EUR 339

PSMD14 sgRNA CRISPR Lentivector set (Human)

K1743901 3 x 1.0 ug
EUR 339

Psmd14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4926502 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4926503 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4926504 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7188002 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7188003 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7188004 1.0 ug DNA
EUR 154

PSMD14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1743902 1.0 ug DNA
EUR 154

PSMD14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1743903 1.0 ug DNA
EUR 154

UBE2R2

UBE2R2 Antibody
44699-50ul 50ul
EUR 187
UBE2R2 Antibody
DF2262 200ul
EUR 304
Description: UBE2R2 antibody detects endogenous levels of total UBE2R2.
UBE2R2 siRNA
20-abx938808
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2R2 siRNA
20-abx938809
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2R2 Antibody
ABD2262 100 ug
EUR 438
UBE2R2 Blocking Peptide
DF2262-BP 1mg
EUR 195
UBE2R2 Conjugated Antibody
C44699 100ul
EUR 397
UBE2R2 cloning plasmid
CSB-CL765138HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 717
  • Sequence: atggcccagcagcagatgaccagctcgcagaaggccctgatgctcgagctgaaatccctgcaggaggaaccggtggagggcttccggatcaccctggtggacgagtccgacctctacaactgggaggtggccatcttcggaccccccaacaccctctacgaaggcggctacttcaa
  • Show more
Description: A cloning plasmid for the UBE2R2 gene.
UBE2R2 Rabbit pAb
A7373-100ul 100 ul
EUR 308
UBE2R2 Rabbit pAb
A7373-200ul 200 ul
EUR 459
UBE2R2 Rabbit pAb
A7373-20ul 20 ul
EUR 183
UBE2R2 Rabbit pAb
A7373-50ul 50 ul
EUR 223
Anti-UBE2R2 antibody
STJ29510 100 µl
EUR 277
Description: Protein kinase CK2 is a ubiquitous and pleiotropic Ser/Thr protein kinase involved in cell growth and transformation. This gene encodes a protein similar to the E2 ubiquitin conjugating enzyme UBC3/CDC34. Studies suggest that CK2-dependent phosphorylation of this ubiquitin-conjugating enzyme functions by regulating beta-TrCP substrate recognition and induces its interaction with beta-TrCP, enhancing beta-catenin degradation.
Human recombinant UBE2R2 (Ubc3B)
6437-3
EUR 392
Polyclonal UBE2R2 Antibody (Center)
APR04467G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2R2 (Center). This antibody is tested and proven to work in the following applications:
UBE2R2 protein (His tag)
80R-3507 50 ug
EUR 424
Description: Purified recombinant UBE2R2 protein (His tag)
Mouse UBE2R2 shRNA Plasmid
20-abx976235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UBE2R2 shRNA Plasmid
20-abx960328
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2R2 Recombinant Protein (Human)
RP033742 100 ug Ask for price
UBE2R2 Recombinant Protein (Mouse)
RP182720 100 ug Ask for price
UBE2R2 ORF Vector (Human) (pORF)
ORF011248 1.0 ug DNA
EUR 95
Ube2r2 ORF Vector (Mouse) (pORF)
ORF060908 1.0 ug DNA
EUR 506
Ube2r2 sgRNA CRISPR Lentivector set (Mouse)
K4799701 3 x 1.0 ug
EUR 339
UBE2R2 sgRNA CRISPR Lentivector set (Human)
K2574201 3 x 1.0 ug
EUR 339
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
20-abx006931
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
20-abx149124
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
abx031194-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
abx031194-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Monoclonal UBE2R2 Antibody (monoclonal) (M01), Clone: 5E8
AMM04283G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UBE2R2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5E8. This antibody is applicable in WB, IP, E
Ube2r2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4799702 1.0 ug DNA
EUR 154
Ube2r2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4799703 1.0 ug DNA
EUR 154
Ube2r2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4799704 1.0 ug DNA
EUR 154
UBE2R2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2574202 1.0 ug DNA
EUR 154
UBE2R2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2574203 1.0 ug DNA
EUR 154
UBE2R2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2574204 1.0 ug DNA
EUR 154
UBE2R2 Protein Vector (Mouse) (pPB-C-His)
PV243630 500 ng
EUR 603
UBE2R2 Protein Vector (Mouse) (pPB-N-His)
PV243631 500 ng
EUR 603
UBE2R2 Protein Vector (Mouse) (pPM-C-HA)
PV243632 500 ng
EUR 603
UBE2R2 Protein Vector (Mouse) (pPM-C-His)
PV243633 500 ng
EUR 603
UBE2R2 Protein Vector (Human) (pPB-C-His)
PV044989 500 ng
EUR 329
UBE2R2 Protein Vector (Human) (pPB-N-His)
PV044990 500 ng
EUR 329
UBE2R2 Protein Vector (Human) (pPM-C-HA)
PV044991 500 ng
EUR 329
UBE2R2 Protein Vector (Human) (pPM-C-His)
PV044992 500 ng
EUR 329
Recombinant Human UBE2R2 Protein, His, E.coli-10ug
QP13867-10ug 10ug
EUR 201
Recombinant Human UBE2R2 Protein, His, E.coli-1mg
QP13867-1mg 1mg
EUR 5251
Recombinant Human UBE2R2 Protein, His, E.coli-2ug
QP13867-2ug 2ug
EUR 155
Ube2r2 3'UTR Luciferase Stable Cell Line
TU121474 1.0 ml Ask for price
UBE2R2 3'UTR GFP Stable Cell Line
TU077685 1.0 ml
EUR 2333
Ube2r2 3'UTR GFP Stable Cell Line
TU171474 1.0 ml Ask for price
UBE2R2 3'UTR Luciferase Stable Cell Line
TU027685 1.0 ml
EUR 2333
Rabbit Ubiquitin- conjugating enzyme E2 R2, UBE2R2 ELISA KIT
ELI-23103Ra 96 Tests
EUR 928
Human Ubiquitin- conjugating enzyme E2 R2, UBE2R2 ELISA KIT
ELI-36619h 96 Tests
EUR 824
Mouse Ubiquitin- conjugating enzyme E2 R2, Ube2r2 ELISA KIT
ELI-36620m 96 Tests
EUR 865
UBE2R2 Ubiquitin Conjugating Enzyme E2R 2 Human Recombinant Protein
PROTQ712K3 Regular: 10ug
EUR 317
Description: UBE2R2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 261 amino acids (1-238 a.a) and having a molecular mass of 29.6kDa (Molecular size on SDS-PAGE will appear higher).
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4799705 3 x 1.0 ug
EUR 376
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2574205 3 x 1.0 ug
EUR 376
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4799706 1.0 ug DNA
EUR 167
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4799707 1.0 ug DNA
EUR 167
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4799708 1.0 ug DNA
EUR 167
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2574206 1.0 ug DNA
EUR 167
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2574207 1.0 ug DNA
EUR 167
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2574208 1.0 ug DNA
EUR 167

B3GNTL1

B3GNTL1 siRNA

20-abx900572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNTL1 siRNA

20-abx908792
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNTL1 siRNA

20-abx908793
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNTL1 cloning plasmid

CSB-CL734577HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: ATGCCGTCTATGTTGGTTGTGAACGTGCATTTGGCACCTGGCAGGGCCAACCCTCATGGCGTGTGCGTGAACACATCCCTAAACCATAGTCTAATTTATCCTATTTTTGTAGTTCATGTGAGCAGAATCCAGTGTCTGTGTTCTCGCATCTGGTTTTCACTCCACGTGTTTGGGGT
  • Show more
Description: A cloning plasmid for the B3GNTL1 gene.

Mouse B3gntl1 ELISA KIT

ELI-23966m 96 Tests
EUR 865

Rat B3GNTL1 shRNA Plasmid

20-abx990693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human B3GNTL1 shRNA Plasmid

20-abx965483
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse B3GNTL1 shRNA Plasmid

20-abx980641
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human B3GNTL1 ELISA KIT

ELI-49993h 96 Tests
EUR 824

B3GNTL1 Recombinant Protein (Human)

RP036889 100 ug Ask for price

B3GNTL1 Recombinant Protein (Mouse)

RP118544 100 ug Ask for price

B3GNTL1 Recombinant Protein (Rat)

RP191756 100 ug Ask for price

B3gntl1 ORF Vector (Rat) (pORF)

ORF063920 1.0 ug DNA
EUR 506

B3GNTL1 ORF Vector (Human) (pORF)

ORF012297 1.0 ug DNA
EUR 354

B3gntl1 ORF Vector (Mouse) (pORF)

ORF039516 1.0 ug DNA
EUR 506

B3gntl1 sgRNA CRISPR Lentivector set (Mouse)

K4912101 3 x 1.0 ug
EUR 339

B3gntl1 sgRNA CRISPR Lentivector set (Rat)

K7253701 3 x 1.0 ug
EUR 339

B3GNTL1 sgRNA CRISPR Lentivector set (Human)

K0164601 3 x 1.0 ug
EUR 339

B3gntl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4912102 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4912103 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4912104 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7253702 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7253703 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7253704 1.0 ug DNA
EUR 154

B3GNTL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0164602 1.0 ug DNA
EUR 154

B3GNTL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0164603 1.0 ug DNA
EUR 154

B3GNTL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0164604 1.0 ug DNA
EUR 154

B3GNTL1 Protein Vector (Mouse) (pPB-C-His)

PV158062 500 ng
EUR 603

B3GNTL1 Protein Vector (Mouse) (pPB-N-His)

PV158063 500 ng
EUR 603

B3GNTL1 Protein Vector (Mouse) (pPM-C-HA)

PV158064 500 ng
EUR 603

B3GNTL1 Protein Vector (Mouse) (pPM-C-His)

PV158065 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPB-C-His)

PV255678 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPB-N-His)

PV255679 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPM-C-HA)

PV255680 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPM-C-His)

PV255681 500 ng
EUR 603

B3GNTL1 Protein Vector (Human) (pPB-His-MBP)

PV325978 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPB-His-GST)

PV325979 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPB-C-His)

PV049185 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPB-N-His)

PV049186 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPM-C-HA)

PV049187 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPM-C-His)

PV049188 500 ng
EUR 481

B3gntl1 3'UTR GFP Stable Cell Line

TU152478 1.0 ml Ask for price

B3gntl1 3'UTR Luciferase Stable Cell Line

TU102478 1.0 ml Ask for price

B3gntl1 3'UTR Luciferase Stable Cell Line

TU201186 1.0 ml Ask for price

B3gntl1 3'UTR GFP Stable Cell Line

TU251186 1.0 ml Ask for price

B3GNTL1 3'UTR GFP Stable Cell Line

TU051585 1.0 ml
EUR 1394

B3GNTL1 3'UTR Luciferase Stable Cell Line

TU001585