GNAT2

GNAT2 siRNA

20-abx918165
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAT2 antibody

70R-36685 100 ug
EUR 327
Description: Rabbit Polyclonal GNAT2 antibody

GNAT2 Antibody

ABD13114 100 ug
EUR 438

GNAT2 Antibody

ABD4110 100 ug
EUR 438

GNAT2 Antibody

34729-100ul 100ul
EUR 252

GNAT2 Antibody

34729-50ul 50ul
EUR 187

GNAT2 antibody

23007-100ul 100ul
EUR 390

GNAT2 antibody

70R-13601 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAT2 antibody

GNAT2 Antibody

DF4110 200ul
EUR 304
Description: GNAT2 Antibody detects endogenous levels of total GNAT2.

GNAT2 Antibody

CSB-PA237874-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody

CSB-PA237874-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody

1-CSB-PA008888
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GNAT2 Antibody

1-CSB-PA009599LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GNAT2 Conjugated Antibody

C34729 100ul
EUR 397

GNAT2 cloning plasmid

CSB-CL009599HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgggaagtggagccagtgctgaggacaaagaactggccaagaggtccaaggagctagaaaagaagctgcaggaggatgctgataaggaagccaagactgtcaagctgctactgctgggtgctggggagtcaggaaagagcaccatcgtcaaacagatgaagatcattcaccagg
  • Show more
Description: A cloning plasmid for the GNAT2 gene.

Anti-GNAT2 Antibody

A06518 100ul
EUR 397
Description: Rabbit Polyclonal GNAT2 Antibody. Validated in WB and tested in Human, Mouse.

GNAT2 Rabbit pAb

A10352-100ul 100 ul
EUR 308

GNAT2 Rabbit pAb

A10352-200ul 200 ul
EUR 459

GNAT2 Rabbit pAb

A10352-20ul 20 ul
EUR 183

GNAT2 Rabbit pAb

A10352-50ul 50 ul
EUR 223

GNAT2 Blocking Peptide

DF4110-BP 1mg
EUR 195

pENTR223-GNAT2 vector

PVT12001 2 ug
EUR 308

Anti-GNAT2 antibody

STJ112390 100 µl
EUR 277
Description: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones.

Polyclonal GNAT2 Antibody (Center)

APR12053G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAT2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Gnat2 ELISA KIT

ELI-27344m 96 Tests
EUR 865

Human GNAT2 ELISA KIT

ELI-43684h 96 Tests
EUR 824

Bovine GNAT2 ELISA KIT

ELI-31794b 96 Tests
EUR 928

Mouse GNAT2 shRNA Plasmid

20-abx970585
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAT2 shRNA Plasmid

20-abx951852
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAT2 Antibody, HRP conjugated

1-CSB-PA009599LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAT2 Antibody, FITC conjugated

1-CSB-PA009599LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAT2 Antibody, Biotin conjugated

1-CSB-PA009599LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAT2 Recombinant Protein (Human)

RP013492 100 ug Ask for price

GNAT2 Recombinant Protein (Rat)

RP202979 100 ug Ask for price

GNAT2 Recombinant Protein (Mouse)

RP138947 100 ug Ask for price

GNAT2 ORF Vector (Human) (pORF)

ORF004498 1.0 ug DNA
EUR 95

Gnat2 ORF Vector (Rat) (pORF)

ORF067661 1.0 ug DNA
EUR 506

Gnat2 ORF Vector (Mouse) (pORF)

ORF046317 1.0 ug DNA
EUR 506

GNAT2 sgRNA CRISPR Lentivector set (Human)

K0875601 3 x 1.0 ug
EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Mouse)

K3838901 3 x 1.0 ug
EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Rat)

K6721101 3 x 1.0 ug
EUR 339

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0875602 1.0 ug DNA
EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0875603 1.0 ug DNA
EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0875604 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3838902 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3838903 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3838904 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6721102 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6721103 1.0 ug DNA
EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6721104 1.0 ug DNA
EUR 154

GNAT2 Protein Vector (Mouse) (pPB-C-His)

PV185266 500 ng
EUR 603

GNAT2 Protein Vector (Mouse) (pPB-N-His)

PV185267 500 ng
EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-HA)

PV185268 500 ng
EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-His)

PV185269 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPB-C-His)

PV270642 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPB-N-His)

PV270643 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-HA)

PV270644 500 ng
EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-His)

PV270645 500 ng
EUR 603

GNAT2 Protein Vector (Human) (pPB-C-His)

PV017989 500 ng
EUR 329

GNAT2 Protein Vector (Human) (pPB-N-His)

PV017990 500 ng
EUR 329