GNAT2 siRNA
20-abx918165	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAT2 antibody
70R-36685	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal GNAT2 antibody

GNAT2 Antibody
ABD13114	Lifescience Market	100 ug	EUR 438

GNAT2 Antibody
ABD4110	Lifescience Market	100 ug	EUR 438

GNAT2 Antibody
34729-100ul	SAB	100ul	EUR 252

GNAT2 Antibody
34729-50ul	SAB	50ul	EUR 187

GNAT2 antibody
23007-100ul	SAB	100ul	EUR 390

GNAT2 antibody
70R-13601	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAT2 antibody

GNAT2 Antibody
DF4110	Affbiotech	200ul	EUR 304
Description: GNAT2 Antibody detects endogenous levels of total GNAT2.

GNAT2 Antibody
CSB-PA237874-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody
CSB-PA237874-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GNAT2 Antibody
1-CSB-PA008888	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GNAT2 Antibody
1-CSB-PA009599LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

GNAT2 Conjugated Antibody
C34729	SAB	100ul	EUR 397

GNAT2 cloning plasmid
CSB-CL009599HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1065 Sequence: atgggaagtggagccagtgctgaggacaaagaactggccaagaggtccaaggagctagaaaagaagctgcaggaggatgctgataaggaagccaagactgtcaagctgctactgctgggtgctggggagtcaggaaagagcaccatcgtcaaacagatgaagatcattcaccagg Show more
Description: A cloning plasmid for the GNAT2 gene.

Anti-GNAT2 Antibody
A06518	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GNAT2 Antibody. Validated in WB and tested in Human, Mouse.

GNAT2 Rabbit pAb
A10352-100ul	Abclonal	100 ul	EUR 308

GNAT2 Rabbit pAb
A10352-200ul	Abclonal	200 ul	EUR 459

GNAT2 Rabbit pAb
A10352-20ul	Abclonal	20 ul	EUR 183

GNAT2 Rabbit pAb
A10352-50ul	Abclonal	50 ul	EUR 223

GNAT2 Blocking Peptide
DF4110-BP	Affbiotech	1mg	EUR 195

pENTR223-GNAT2 vector
PVT12001	Lifescience Market	2 ug	EUR 308

Anti-GNAT2 antibody
STJ112390	St John's Laboratory	100 µl	EUR 277
Description: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones.

Polyclonal GNAT2 Antibody (Center)
APR12053G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAT2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Gnat2 ELISA KIT
ELI-27344m	Lifescience Market	96 Tests	EUR 865

Human GNAT2 ELISA KIT
ELI-43684h	Lifescience Market	96 Tests	EUR 824

Bovine GNAT2 ELISA KIT
ELI-31794b	Lifescience Market	96 Tests	EUR 928

Mouse GNAT2 shRNA Plasmid
20-abx970585	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAT2 shRNA Plasmid
20-abx951852	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNAT2 Antibody, HRP conjugated
1-CSB-PA009599LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAT2 Antibody, FITC conjugated
1-CSB-PA009599LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAT2 Antibody, Biotin conjugated
1-CSB-PA009599LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAT2. Recognizes GNAT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAT2 Recombinant Protein (Human)
RP013492	ABM	100 ug	Ask for price

GNAT2 Recombinant Protein (Rat)
RP202979	ABM	100 ug	Ask for price

GNAT2 Recombinant Protein (Mouse)
RP138947	ABM	100 ug	Ask for price

GNAT2 ORF Vector (Human) (pORF)
ORF004498	ABM	1.0 ug DNA	EUR 95

Gnat2 ORF Vector (Rat) (pORF)
ORF067661	ABM	1.0 ug DNA	EUR 506

Gnat2 ORF Vector (Mouse) (pORF)
ORF046317	ABM	1.0 ug DNA	EUR 506

GNAT2 sgRNA CRISPR Lentivector set (Human)
K0875601	ABM	3 x 1.0 ug	EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Mouse)
K3838901	ABM	3 x 1.0 ug	EUR 339

Gnat2 sgRNA CRISPR Lentivector set (Rat)
K6721101	ABM	3 x 1.0 ug	EUR 339

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0875602	ABM	1.0 ug DNA	EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0875603	ABM	1.0 ug DNA	EUR 154

GNAT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0875604	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3838902	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3838903	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3838904	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6721102	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6721103	ABM	1.0 ug DNA	EUR 154

Gnat2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6721104	ABM	1.0 ug DNA	EUR 154

GNAT2 Protein Vector (Mouse) (pPB-C-His)
PV185266	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Mouse) (pPB-N-His)
PV185267	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-HA)
PV185268	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Mouse) (pPM-C-His)
PV185269	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPB-C-His)
PV270642	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPB-N-His)
PV270643	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-HA)
PV270644	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Rat) (pPM-C-His)
PV270645	ABM	500 ng	EUR 603

GNAT2 Protein Vector (Human) (pPB-C-His)
PV017989	ABM	500 ng	EUR 329

GNAT2 Protein Vector (Human) (pPB-N-His)
PV017990	ABM	500 ng	EUR 329