TBCB

TBCB siRNA
20-abx936214
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBCB antibody
70R-3673 50 ug
EUR 467
Description: Rabbit polyclonal TBCB antibody raised against the C terminal of TBCB
TBCB antibody
70R-20714 50 ul
EUR 435
Description: Rabbit polyclonal TBCB antibody
TBCB antibody
70R-9129 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TBCB antibody
TBCB Antibody
46681-100ul 100ul
EUR 252
TBCB antibody
10R-10259 50 ul
EUR 219
Description: Mouse monoclonal TBCB antibody
TBCB Antibody
1-CSB-PA023226GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
TBCB Antibody
1-CSB-PA03169A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
TBCB Conjugated Antibody
C46681 100ul
EUR 397
anti- TBCB antibody
FNab08517 100µg
EUR 548.75
  • Immunogen: tubulin folding cofactor B
  • Uniprot ID: Q99426
  • Gene ID: 1155
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBCB
TBCB Polyclonal Antibody
ES10401-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBCB from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TBCB Polyclonal Antibody
ES10401-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBCB from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TBCB Polyclonal Antibody
ABP60629-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TBCB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein
TBCB Polyclonal Antibody
ABP60629-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TBCB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein
TBCB Polyclonal Antibody
ABP60629-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBCB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBCB from Human, Mouse. This TBCB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBCB protein
TBCB Rabbit pAb
A3789-100ul 100 ul
EUR 308
TBCB Rabbit pAb
A3789-200ul 200 ul
EUR 459
TBCB Rabbit pAb
A3789-20ul 20 ul Ask for price
TBCB Rabbit pAb
A3789-50ul 50 ul Ask for price
TBCB Polyclonal Antibody
A61254 100 µg
EUR 570.55
Description: kits suitable for this type of research
TBCB Rabbit pAb
A13012-100ul 100 ul
EUR 308
TBCB Rabbit pAb
A13012-200ul 200 ul
EUR 459
TBCB Rabbit pAb
A13012-20ul 20 ul
EUR 183
TBCB Rabbit pAb
A13012-50ul 50 ul
EUR 223
TBCB Rabbit pAb
A13248-100ul 100 ul
EUR 308
TBCB Rabbit pAb
A13248-200ul 200 ul
EUR 459
TBCB Rabbit pAb
A13248-20ul 20 ul
EUR 183
TBCB Rabbit pAb
A13248-50ul 50 ul
EUR 223
TBCB Blocking Peptide
33R-10065 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBCB antibody, catalog no. 70R-3673
Tbcb Blocking Peptide
33R-2942 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tbcb antibody, catalog no. 70R-9129
TBCB cloning plasmid
CSB-CL859929HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atggaggtgacgggggtgtcggcacccacggtgaccgttttcatcagcagctccctcaacaccttccgctccgagaagcgatacagccgcagcctcaccatcgctgagttcaagtgtaaactggagttgctggtgggcagccctgcttcctgcatggaactggagctgtatggagt
  • Show more
Description: A cloning plasmid for the TBCB gene.
Anti-TBCB antibody
PAab08517 100 ug
EUR 386
Anti-TBCB antibody
STJ25779 100 µl
EUR 277
Anti-TBCB antibody
STJ114979 100 µl
EUR 277
Anti-TBCB antibody
STJ115213 100 µl
EUR 277
Anti-TBCB antibody
STJ191559 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBCB
Mouse TBCB shRNA Plasmid
20-abx975596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBCB ELISA KIT|Human
EF003469 96 Tests
EUR 689
Human TBCB shRNA Plasmid
20-abx950829
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBCB protein (His tag)
80R-2321 100 ug
EUR 322
Description: Purified recombinant Human TBCB Protein (His tag)
TBCB Antibody, HRP conjugated
1-CSB-PA03169B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TBCB Antibody, FITC conjugated
1-CSB-PA03169C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TBCB Antibody, Biotin conjugated
1-CSB-PA03169D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TBCB Recombinant Protein (Human)
RP031033 100 ug Ask for price
TBCB Recombinant Protein (Rat)
RP232457 100 ug Ask for price
TBCB Recombinant Protein (Mouse)
RP177578 100 ug Ask for price
Polyclonal TBCB Antibody (N-term)
APR13711G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCB (N-term). This antibody is tested and proven to work in the following applications:
TBCB Polyclonal Antibody, Biotin Conjugated
A61255 100 µg
EUR 570.55
Description: fast delivery possible
TBCB Polyclonal Antibody, FITC Conjugated
A61256 100 µg
EUR 570.55
Description: reagents widely cited
TBCB Polyclonal Antibody, HRP Conjugated
A61257 100 µg
EUR 570.55
Description: Ask the seller for details
Tbcb ORF Vector (Mouse) (pORF)
ORF059194 1.0 ug DNA
EUR 506
TBCB ORF Vector (Human) (pORF)
ORF010345 1.0 ug DNA
EUR 95
Tbcb ORF Vector (Rat) (pORF)
ORF077487 1.0 ug DNA
EUR 506
Tubulin Folding Cofactor B (TBCB) Antibody
20-abx116336
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody
20-abx002740
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody
abx030766-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody
abx030766-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Protein
20-abx260902
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody
20-abx317904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody
abx238517-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TBCB sgRNA CRISPR Lentivector set (Human)
K2342201 3 x 1.0 ug
EUR 339
Tbcb sgRNA CRISPR Lentivector set (Mouse)
K4579101 3 x 1.0 ug
EUR 339
Tbcb sgRNA CRISPR Lentivector set (Rat)
K6648801 3 x 1.0 ug
EUR 339
Recombinant Tubulin Folding Cofactor B (TBCB)
4-RPE725Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99426
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.0kDa
  • Isoelectric Point: 5.1
Description: Recombinant Human Tubulin Folding Cofactor B expressed in: E.coli
Recombinant Tubulin Folding Cofactor B (TBCB)
4-RPE725Mu01
  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9D1E6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.1kDa
  • Isoelectric Point: 5.1
Description: Recombinant Mouse Tubulin Folding Cofactor B expressed in: E.coli
Human Tubulin Folding Cofactor B (TBCB) Protein
20-abx650900
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Tubulin Folding Cofactor B (TBCB) Protein
20-abx650901
  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Folding Cofactor B (TBCB) Antibody (HRP)
20-abx306301
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody (FITC)
20-abx306302
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor B (TBCB) Antibody (Biotin)
20-abx306303
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TBCB sgRNA CRISPR Lentivector (Human) (Target 1)
K2342202 1.0 ug DNA
EUR 154
TBCB sgRNA CRISPR Lentivector (Human) (Target 2)
K2342203 1.0 ug DNA
EUR 154
TBCB sgRNA CRISPR Lentivector (Human) (Target 3)
K2342204 1.0 ug DNA
EUR 154
Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4579102 1.0 ug DNA
EUR 154
Tbcb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4579103 1.0 ug DNA
EUR 154