TBCC antibody
70R-12948	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TBCC antibody

TBCC antibody
70R-20715	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TBCC antibody

TBCC Antibody
1-CSB-PA023227GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

TBCC Antibody
1-CSB-PA023227LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

TBCC siRNA
20-abx936217	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TBCC siRNA
20-abx936218	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TBCC
YF-PA14920	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TBCC

anti-TBCC
YF-PA14921	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TBCC

TBCC Polyclonal Antibody
30070-100ul	SAB	100ul	EUR 252

TBCC Polyclonal Antibody
30070-50ul	SAB	50ul	EUR 187

TBCC cloning plasmid
CSB-CL620895HU1-10ug	Cusabio	10ug	EUR 401
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1041 Sequence: atggagtccgtcagttgctccgctgctgctgtcaggaccggagacatggagtcccagcgggacctgagcctggtgcctgagcggcttcagagacgcgaacaagaacggcagctggaagttgaaaggcggaaacaaaagcggcagaaccaggaggtagagaaggagaacagccact Show more
Description: A cloning plasmid for the TBCC gene.

TBCC cloning plasmid
CSB-CL620895HU2-10ug	Cusabio	10ug	EUR 401
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1041 Sequence: atggagtccgtcagttgctccgctgctgctgtcaggaccggagacatggagtcccagcgggacctgagcctggtgcctgagcggcttcagagacgcgaacaagaacggcagctggaagttgaaaggcggaaacaaaagcggcagaaccaggaggtagagaaggagaacagccact Show more
Description: A cloning plasmid for the TBCC gene.

TBCC Polyclonal Antibody
A53617	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TBCC Rabbit pAb
A17537-100ul	Abclonal	100 ul	EUR 308

TBCC Rabbit pAb
A17537-200ul	Abclonal	200 ul	EUR 459

TBCC Rabbit pAb
A17537-20ul	Abclonal	20 ul	EUR 183

TBCC Rabbit pAb
A17537-50ul	Abclonal	50 ul	EUR 223

anti- TBCC antibody
FNab08518	FN Test	100µg	EUR 548.75
Immunogen: tubulin folding cofactor C Uniprot ID: Q15814 Gene ID: 6903 Research Area: Metabolism
Description: Antibody raised against TBCC

Anti-TBCC antibody
PAab08518	Lifescience Market	100 ug	EUR 386

Anti-TBCC antibody
STJ119629	St John's Laboratory	100 µl	EUR 277
Description: Cofactor C is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]

Anti-TBCC (3D3)
YF-MA15741	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TBCC

TBCC protein (His tag)
80R-2417	Fitzgerald	20 ug	EUR 322
Description: Purified recombinant TBCC protein (His tag)

TBCC ELISA KIT|Human
EF003470	Lifescience Market	96 Tests	EUR 689

Mouse TBCC shRNA Plasmid
20-abx977840	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TBCC Polyclonal Conjugated Antibody
C30070	SAB	100ul	EUR 397

TBCC Antibody, HRP conjugated
1-CSB-PA023227LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBCC Antibody, FITC conjugated
1-CSB-PA023227LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBCC Antibody, Biotin conjugated
1-CSB-PA023227LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TBCC shRNA Plasmid
20-abx954729	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TBCC Recombinant Protein (Rat)
RP232460	ABM	100 ug	Ask for price

TBCC Recombinant Protein (Human)
RP031036	ABM	100 ug	Ask for price

TBCC Recombinant Protein (Human)
RP031039	ABM	100 ug	Ask for price

TBCC Recombinant Protein (Mouse)
RP177581	ABM	100 ug	Ask for price

Monoclonal TBCC Antibody, Clone: 7G6H1
AMM08122G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human TBCC. The antibodies are raised in Mouse and are from clone 7G6H1. This antibody is applicable in WB and IHC, FC, ICC, E

TBCC Polyclonal Antibody, Biotin Conjugated
A53614	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TBCC Polyclonal Antibody, FITC Conjugated
A53615	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TBCC Polyclonal Antibody, HRP Conjugated
A53616	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Tbcc ORF Vector (Rat) (pORF)
ORF077488	ABM	1.0 ug DNA	EUR 506

TBCC ORF Vector (Human) (pORF)
ORF010346	ABM	1.0 ug DNA	EUR 95

TBCC ORF Vector (Human) (pORF)
ORF010347	ABM	1.0 ug DNA	EUR 95

Tbcc ORF Vector (Mouse) (pORF)
ORF059195	ABM	1.0 ug DNA	EUR 506

Human Tubulin-specific chaperone C (TBCC)
1-CSB-EP023227HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 43 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tubulin-specific chaperone C(TBCC) expressed in E.coli

Tubulin-Specific Chaperone C (TBCC) Antibody
abx027410-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tubulin-Specific Chaperone C (TBCC) Antibody
abx027410-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tubulin-Specific Chaperone C (TBCC) Antibody
abx224254-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Tubulin-Specific Chaperone C (TBCC) Antibody
20-abx110306	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Folding Cofactor C (TBCC) Antibody
20-abx116337	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tubulin-Specific Chaperone C (TBCC) Antibody
abx122727-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tubulin Folding Cofactor C (TBCC) Protein
20-abx263300	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Tubulin-Specific Chaperone C (TBCC) Antibody
abx238518-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tbcc sgRNA CRISPR Lentivector set (Rat)
K6127501	ABM	3 x 1.0 ug	EUR 339

Tbcc sgRNA CRISPR Lentivector set (Mouse)
K4596401	ABM	3 x 1.0 ug	EUR 339

TBCC sgRNA CRISPR Lentivector set (Human)
K2342301	ABM	3 x 1.0 ug	EUR 339

Tbcc sgRNA CRISPR Lentivector (Rat) (Target 1)
K6127502	ABM	1.0 ug DNA	EUR 154

Tbcc sgRNA CRISPR Lentivector (Rat) (Target 2)
K6127503	ABM	1.0 ug DNA	EUR 154

Tbcc sgRNA CRISPR Lentivector (Rat) (Target 3)
K6127504	ABM	1.0 ug DNA	EUR 154

Tbcc sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4596402	ABM	1.0 ug DNA	EUR 154

Tbcc sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4596403	ABM	1.0 ug DNA	EUR 154

Tbcc sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4596404	ABM	1.0 ug DNA	EUR 154

TBCC sgRNA CRISPR Lentivector (Human) (Target 1)
K2342302	ABM	1.0 ug DNA	EUR 154

TBCC sgRNA CRISPR Lentivector (Human) (Target 2)
K2342303	ABM	1.0 ug DNA	EUR 154

TBCC sgRNA CRISPR Lentivector (Human) (Target 3)
K2342304	ABM	1.0 ug DNA	EUR 154

TBCC Protein Vector (Rat) (pPB-C-His)
PV309950	ABM	500 ng	EUR 603

TBCC Protein Vector (Rat) (pPB-N-His)
PV309951	ABM	500 ng	EUR 603

TBCC Protein Vector (Rat) (pPM-C-HA)
PV309952	ABM	500 ng	EUR 603

TBCC Protein Vector (Rat) (pPM-C-His)
PV309953	ABM	500 ng	EUR 603

TBCC Protein Vector (Human) (pPB-C-His)
PV041381	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPB-N-His)
PV041382	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPM-C-HA)
PV041383	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPM-C-His)
PV041384	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPB-C-His)
PV041385	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPB-N-His)
PV041386	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPM-C-HA)
PV041387	ABM	500 ng	EUR 329

TBCC Protein Vector (Human) (pPM-C-His)
PV041388	ABM	500 ng	EUR 329

TBCC Protein Vector (Mouse) (pPB-C-His)
PV236778	ABM	500 ng	EUR 603