TBCC antibody
70R-12948 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TBCC antibody
TBCC antibody
70R-20715 50 ul
EUR 435
Description: Rabbit polyclonal TBCC antibody
TBCC Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
TBCC Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA14920 50 ul
EUR 363
Description: Mouse polyclonal to TBCC
YF-PA14921 50 ug
EUR 363
Description: Mouse polyclonal to TBCC
TBCC Polyclonal Antibody
30070-100ul 100ul
EUR 252
TBCC Polyclonal Antibody
30070-50ul 50ul
EUR 187
TBCC cloning plasmid
CSB-CL620895HU1-10ug 10ug
EUR 401
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atggagtccgtcagttgctccgctgctgctgtcaggaccggagacatggagtcccagcgggacctgagcctggtgcctgagcggcttcagagacgcgaacaagaacggcagctggaagttgaaaggcggaaacaaaagcggcagaaccaggaggtagagaaggagaacagccact
  • Show more
Description: A cloning plasmid for the TBCC gene.
TBCC cloning plasmid
CSB-CL620895HU2-10ug 10ug
EUR 401
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atggagtccgtcagttgctccgctgctgctgtcaggaccggagacatggagtcccagcgggacctgagcctggtgcctgagcggcttcagagacgcgaacaagaacggcagctggaagttgaaaggcggaaacaaaagcggcagaaccaggaggtagagaaggagaacagccact
  • Show more
Description: A cloning plasmid for the TBCC gene.
TBCC Polyclonal Antibody
A53617 100 µg
EUR 570.55
Description: The best epigenetics products
TBCC Rabbit pAb
A17537-100ul 100 ul
EUR 308
TBCC Rabbit pAb
A17537-200ul 200 ul
EUR 459
TBCC Rabbit pAb
A17537-20ul 20 ul
EUR 183
TBCC Rabbit pAb
A17537-50ul 50 ul
EUR 223
anti- TBCC antibody
FNab08518 100µg
EUR 548.75
  • Immunogen: tubulin folding cofactor C
  • Uniprot ID: Q15814
  • Gene ID: 6903
  • Research Area: Metabolism
Description: Antibody raised against TBCC
Anti-TBCC antibody
PAab08518 100 ug
EUR 386
Anti-TBCC antibody
STJ119629 100 µl
EUR 277
Description: Cofactor C is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Anti-TBCC (3D3)
YF-MA15741 100 ug
EUR 363
Description: Mouse monoclonal to TBCC
TBCC protein (His tag)
80R-2417 20 ug
EUR 322
Description: Purified recombinant TBCC protein (His tag)
EF003470 96 Tests
EUR 689
Mouse TBCC shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBCC Polyclonal Conjugated Antibody
C30070 100ul
EUR 397
TBCC Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TBCC Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TBCC Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCC. Recognizes TBCC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human TBCC shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBCC Recombinant Protein (Rat)
RP232460 100 ug Ask for price
TBCC Recombinant Protein (Human)
RP031036 100 ug Ask for price
TBCC Recombinant Protein (Human)
RP031039 100 ug Ask for price
TBCC Recombinant Protein (Mouse)
RP177581 100 ug Ask for price
Monoclonal TBCC Antibody, Clone: 7G6H1
AMM08122G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TBCC. The antibodies are raised in Mouse and are from clone 7G6H1. This antibody is applicable in WB and IHC, FC, ICC, E
TBCC Polyclonal Antibody, Biotin Conjugated
A53614 100 µg
EUR 570.55
Description: Ask the seller for details
TBCC Polyclonal Antibody, FITC Conjugated
A53615 100 µg
EUR 570.55
Description: The best epigenetics products
TBCC Polyclonal Antibody, HRP Conjugated
A53616 100 µg
EUR 570.55
Description: kits suitable for this type of research
Tbcc ORF Vector (Rat) (pORF)
ORF077488 1.0 ug DNA
EUR 506
TBCC ORF Vector (Human) (pORF)
ORF010346 1.0 ug DNA
EUR 95
TBCC ORF Vector (Human) (pORF)
ORF010347 1.0 ug DNA
EUR 95
Tbcc ORF Vector (Mouse) (pORF)
ORF059195 1.0 ug DNA
EUR 506
Human Tubulin-specific chaperone C (TBCC)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 43 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tubulin-specific chaperone C(TBCC) expressed in E.coli
Tubulin-Specific Chaperone C (TBCC) Antibody
abx027410-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone C (TBCC) Antibody
abx027410-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone C (TBCC) Antibody
abx224254-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone C (TBCC) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor C (TBCC) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone C (TBCC) Antibody
abx122727-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor C (TBCC) Protein
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone C (TBCC) Antibody
abx238518-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Tbcc sgRNA CRISPR Lentivector set (Rat)
K6127501 3 x 1.0 ug
EUR 339
Tbcc sgRNA CRISPR Lentivector set (Mouse)
K4596401 3 x 1.0 ug
EUR 339
TBCC sgRNA CRISPR Lentivector set (Human)
K2342301 3 x 1.0 ug
EUR 339
Tbcc sgRNA CRISPR Lentivector (Rat) (Target 1)
K6127502 1.0 ug DNA
EUR 154
Tbcc sgRNA CRISPR Lentivector (Rat) (Target 2)
K6127503 1.0 ug DNA
EUR 154
Tbcc sgRNA CRISPR Lentivector (Rat) (Target 3)
K6127504 1.0 ug DNA
EUR 154
Tbcc sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4596402 1.0 ug DNA
EUR 154
Tbcc sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4596403 1.0 ug DNA
EUR 154
Tbcc sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4596404 1.0 ug DNA
EUR 154
TBCC sgRNA CRISPR Lentivector (Human) (Target 1)
K2342302 1.0 ug DNA
EUR 154
TBCC sgRNA CRISPR Lentivector (Human) (Target 2)
K2342303 1.0 ug DNA
EUR 154
TBCC sgRNA CRISPR Lentivector (Human) (Target 3)
K2342304 1.0 ug DNA
EUR 154
TBCC Protein Vector (Rat) (pPB-C-His)
PV309950 500 ng
EUR 603
TBCC Protein Vector (Rat) (pPB-N-His)
PV309951 500 ng
EUR 603
TBCC Protein Vector (Rat) (pPM-C-HA)
PV309952 500 ng
EUR 603
TBCC Protein Vector (Rat) (pPM-C-His)
PV309953 500 ng
EUR 603
TBCC Protein Vector (Human) (pPB-C-His)
PV041381 500 ng
EUR 329
TBCC Protein Vector (Human) (pPB-N-His)
PV041382 500 ng
EUR 329
TBCC Protein Vector (Human) (pPM-C-HA)
PV041383 500 ng
EUR 329
TBCC Protein Vector (Human) (pPM-C-His)
PV041384 500 ng
EUR 329
TBCC Protein Vector (Human) (pPB-C-His)
PV041385 500 ng
EUR 329
TBCC Protein Vector (Human) (pPB-N-His)
PV041386 500 ng
EUR 329
TBCC Protein Vector (Human) (pPM-C-HA)
PV041387 500 ng
EUR 329
TBCC Protein Vector (Human) (pPM-C-His)
PV041388 500 ng
EUR 329
TBCC Protein Vector (Mouse) (pPB-C-His)
PV236778 500 ng
EUR 603