GOSR1

GOSR1 siRNA

20-abx902243
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GOSR1 siRNA

20-abx918295
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GOSR1 siRNA

20-abx918296
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GOSR1 antibody

70R-35248 100 ug
EUR 327
Description: Purified Rabbit polyclonal GOSR1 antibody

GOSR1 antibody

70R-9802 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GOSR1 antibody

GOSR1 Antibody

1-CSB-PA009677ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GOSR1 Antibody

1-CSB-PA009677ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

GOSR1 Antibody

1-CSB-PA009677GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GOSR1 Antibody

1-CSB-PA080016
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GOSR1. Recognizes GOSR1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

anti-GOSR1

YF-PA16364 50 ul
EUR 363
Description: Mouse polyclonal to GOSR1

anti-GOSR1

YF-PA16365 50 ug
EUR 363
Description: Mouse polyclonal to GOSR1

anti-GOSR1

YF-PA16366 100 ul
EUR 403
Description: Rabbit polyclonal to GOSR1

GOSR1 cloning plasmid

CSB-CL009677HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 528
  • Sequence: atggcggcagggaccagcagttactgggaagatctcaggaaacaggctcgacagctggaaaatgaacttgacctgaaactagtttccttcagcaaactatgtacaagttacagtcatagcagtacccgagatggaagacgcgacaggtatagttctgatacaacaccccttttaaa
  • Show more
Description: A cloning plasmid for the GOSR1 gene.

GOSR1 Rabbit pAb

A4316-100ul 100 ul
EUR 308

GOSR1 Rabbit pAb

A4316-200ul 200 ul
EUR 459

GOSR1 Rabbit pAb

A4316-20ul 20 ul
EUR 183

GOSR1 Rabbit pAb

A4316-50ul 50 ul
EUR 223

GOSR1 Blocking Peptide

33R-3986 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GOSR1 antibody, catalog no. 70R-9802

GOSR1 Polyclonal Antibody

30545-100ul 100ul
EUR 252

GOSR1 Polyclonal Antibody

30545-50ul 50ul
EUR 187

Anti-GOSR1 antibody

STJ23876 100 µl
EUR 277
Description: This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-GOSR1 (2C2)

YF-MA16894 100 ug
EUR 363
Description: Mouse monoclonal to GOSR1

GOSR1 Polyclonal Conjugated Antibody

C30545 100ul
EUR 397

Mouse GOSR1 shRNA Plasmid

20-abx974326
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GOSR1 shRNA Plasmid

20-abx987080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GOSR1 shRNA Plasmid

20-abx956332
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-GOSR1/Gs28 Antibody

A09064 100ul
EUR 397
Description: Rabbit Polyclonal GOSR1/Gs28 Antibody. Validated in WB and tested in Human.

GOSR1 Recombinant Protein (Human)

RP013663 100 ug Ask for price

GOSR1 Recombinant Protein (Rat)

RP203135 100 ug Ask for price

GOSR1 Recombinant Protein (Mouse)

RP139184 100 ug Ask for price

GOSR1 ORF Vector (Human) (pORF)

ORF004555 1.0 ug DNA
EUR 95

Gosr1 ORF Vector (Rat) (pORF)

ORF067713 1.0 ug DNA
EUR 506

Gosr1 ORF Vector (Mouse) (pORF)

ORF046396 1.0 ug DNA
EUR 506

GOSR1 sgRNA CRISPR Lentivector set (Human)

K0883901 3 x 1.0 ug
EUR 339

Gosr1 sgRNA CRISPR Lentivector set (Mouse)

K3051901 3 x 1.0 ug
EUR 339

Gosr1 sgRNA CRISPR Lentivector set (Rat)

K7080601 3 x 1.0 ug
EUR 339

GOSR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0883902 1.0 ug DNA
EUR 154

GOSR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0883903 1.0 ug DNA
EUR 154

GOSR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0883904 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3051902 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3051903 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3051904 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7080602 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7080603 1.0 ug DNA
EUR 154

Gosr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7080604 1.0 ug DNA
EUR 154

GOSR1 Protein Vector (Mouse) (pPB-C-His)

PV185582 500 ng
EUR 603

GOSR1 Protein Vector (Mouse) (pPB-N-His)

PV185583 500 ng
EUR 603

GOSR1 Protein Vector (Mouse) (pPM-C-HA)

PV185584 500 ng
EUR 603

GOSR1 Protein Vector (Mouse) (pPM-C-His)

PV185585 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPB-C-His)

PV270850 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPB-N-His)

PV270851 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPM-C-HA)

PV270852 500 ng
EUR 603

GOSR1 Protein Vector (Rat) (pPM-C-His)

PV270853 500 ng
EUR 603

GOSR1 Protein Vector (Human) (pPB-C-His)

PV018217 500 ng
EUR 329

GOSR1 Protein Vector (Human) (pPB-N-His)

PV018218 500 ng
EUR 329

GOSR1 Protein Vector (Human) (pPM-C-HA)

PV018219 500 ng
EUR 329

GOSR1 Protein Vector (Human) (pPM-C-His)

PV018220 500 ng
EUR 329

Gosr1 3'UTR Luciferase Stable Cell Line

TU205270 1.0 ml Ask for price

Gosr1 3'UTR GFP Stable Cell Line

TU158910 1.0 ml Ask for price

GOSR1 3'UTR Luciferase Stable Cell Line

TU009083 1.0 ml
EUR 2333