GSPT2

GSPT2 Antibody

47422-100ul 100ul
EUR 252

GSPT2 antibody

10R-4257 100 ul
EUR 726
Description: Mouse monoclonal GSPT2 antibody

GSPT2 Antibody

DF12622 200ul
EUR 304
Description: GSPT2 Antibody detects endogenous levels of GSPT2.

GSPT2 antibody

70R-3859 50 ug
EUR 467
Description: Rabbit polyclonal GSPT2 antibody raised against the middle region of GSPT2

GSPT2 antibody

70R-5565 50 ug
EUR 467
Description: Rabbit polyclonal GSPT2 antibody raised against the N terminal of GSPT2

GSPT2 Antibody

1-CSB-PA009967GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GSPT2. Recognizes GSPT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GSPT2 siRNA

20-abx918797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSPT2 siRNA

20-abx918798
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSPT2 Blocking Peptide

33R-3163 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSPT2 antibody, catalog no. 70R-3859

GSPT2 Blocking Peptide

33R-5685 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSPT2 antibody, catalog no. 70R-5565

GSPT2 Blocking Peptide

DF12622-BP 1mg
EUR 195

GSPT2 Conjugated Antibody

C47422 100ul
EUR 397

GSPT2 cloning plasmid

CSB-CL812896HU-10ug 10ug
EUR 637
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1887
  • Sequence: atggattcgggtagcagcagcagcgactcggcgcccgattgctgggaccaggtggacatggaatccacggggtcggccccgagcggggatggagtctcctctgcggtggccgaggcccagcgcgagcccctcagctcggctttcagccgtaagctcaacgtcaacgccaagccct
  • Show more
Description: A cloning plasmid for the GSPT2 gene.

GSPT2 Rabbit pAb

A4578-100ul 100 ul
EUR 308

GSPT2 Rabbit pAb

A4578-200ul 200 ul
EUR 459

GSPT2 Rabbit pAb

A4578-20ul 20 ul Ask for price

GSPT2 Rabbit pAb

A4578-50ul 50 ul Ask for price

anti- GSPT2 antibody

FNab03681 100µg
EUR 505.25
  • Immunogen: G1 to S phase transition 2
  • Uniprot ID: Q8IYD1
  • Gene ID: 23708
  • Research Area: Metabolism
Description: Antibody raised against GSPT2

Anti-GSPT2 antibody

PAab03681 100 ug
EUR 355

Anti-GSPT2 antibody

STJ26738 100 µl
EUR 277
Description: This gene encodes a GTPase that belongs to the GTP-binding elongation factor family. The encoded protein is a polypeptide release factor that complexes with eukaryotic peptide chain release factor 1 to mediate translation termination. This protein may also be involved in mRNA stability.

Human GSPT2 ELISA KIT

ELI-09714h 96 Tests
EUR 824

Mouse Gspt2 ELISA KIT

ELI-10024m 96 Tests
EUR 865

GSPT2 ELISA KIT|Human

EF010012 96 Tests
EUR 689

Human GSPT2 shRNA Plasmid

20-abx958439
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GSPT2 shRNA Plasmid

20-abx970683
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSPT2 Recombinant Protein (Human)

RP014092 100 ug Ask for price

GSPT2 Recombinant Protein (Rat)

RP203819 100 ug Ask for price

GSPT2 Recombinant Protein (Mouse)

RP140222 100 ug Ask for price

Gspt2 ORF Vector (Rat) (pORF)

ORF067941 1.0 ug DNA
EUR 506

GSPT2 ORF Vector (Human) (pORF)

ORF004698 1.0 ug DNA
EUR 95

Gspt2 ORF Vector (Mouse) (pORF)

ORF046742 1.0 ug DNA
EUR 506

Gspt2 sgRNA CRISPR Lentivector set (Rat)

K6317501 3 x 1.0 ug
EUR 339

Gspt2 sgRNA CRISPR Lentivector set (Mouse)

K4000301 3 x 1.0 ug
EUR 339

GSPT2 sgRNA CRISPR Lentivector set (Human)

K0912301 3 x 1.0 ug
EUR 339

Gspt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6317502 1.0 ug DNA
EUR 154

Gspt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6317503 1.0 ug DNA
EUR 154

Gspt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6317504 1.0 ug DNA
EUR 154

Gspt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4000302 1.0 ug DNA
EUR 154

Gspt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4000303 1.0 ug DNA
EUR 154

Gspt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4000304 1.0 ug DNA
EUR 154

GSPT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0912302 1.0 ug DNA
EUR 154

GSPT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0912303 1.0 ug DNA
EUR 154

GSPT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0912304 1.0 ug DNA
EUR 154

GSPT2 Protein Vector (Rat) (pPB-C-His)

PV271762 500 ng
EUR 603

GSPT2 Protein Vector (Rat) (pPB-N-His)

PV271763 500 ng
EUR 603

GSPT2 Protein Vector (Rat) (pPM-C-HA)

PV271764 500 ng
EUR 603

GSPT2 Protein Vector (Rat) (pPM-C-His)

PV271765 500 ng
EUR 603

GSPT2 Protein Vector (Mouse) (pPB-C-His)

PV186966 500 ng
EUR 603

GSPT2 Protein Vector (Mouse) (pPB-N-His)

PV186967 500 ng
EUR 603

GSPT2 Protein Vector (Mouse) (pPM-C-HA)

PV186968 500 ng
EUR 603

GSPT2 Protein Vector (Mouse) (pPM-C-His)

PV186969 500 ng
EUR 603

GSPT2 Protein Vector (Human) (pPB-C-His)

PV018789 500 ng
EUR 329

GSPT2 Protein Vector (Human) (pPB-N-His)

PV018790 500 ng
EUR 329

GSPT2 Protein Vector (Human) (pPM-C-HA)

PV018791 500 ng
EUR 329

GSPT2 Protein Vector (Human) (pPM-C-His)

PV018792 500 ng
EUR 329

Gspt2 3'UTR Luciferase Stable Cell Line

TU109168 1.0 ml Ask for price

Gspt2 3'UTR Luciferase Stable Cell Line

TU205507 1.0 ml Ask for price

Gspt2 3'UTR GFP Stable Cell Line

TU159168 1.0 ml Ask for price

Gspt2 3'UTR GFP Stable Cell Line

TU255507 1.0 ml Ask for price

GSPT2 3'UTR GFP Stable Cell Line

TU059375 1.0 ml
EUR 1394