GSPT2 Antibody
47422-100ul	SAB	100ul	EUR 252

GSPT2 antibody
10R-4257	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal GSPT2 antibody

GSPT2 Antibody
DF12622	Affbiotech	200ul	EUR 304
Description: GSPT2 Antibody detects endogenous levels of GSPT2.

GSPT2 antibody
70R-3859	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GSPT2 antibody raised against the middle region of GSPT2

GSPT2 antibody
70R-5565	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GSPT2 antibody raised against the N terminal of GSPT2

GSPT2 Antibody
1-CSB-PA009967GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GSPT2. Recognizes GSPT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GSPT2 siRNA
20-abx918797	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSPT2 siRNA
20-abx918798	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSPT2 Blocking Peptide
33R-3163	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSPT2 antibody, catalog no. 70R-3859

GSPT2 Blocking Peptide
33R-5685	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSPT2 antibody, catalog no. 70R-5565

GSPT2 Blocking Peptide
DF12622-BP	Affbiotech	1mg	EUR 195

GSPT2 Conjugated Antibody
C47422	SAB	100ul	EUR 397

GSPT2 cloning plasmid
CSB-CL812896HU-10ug	Cusabio	10ug	EUR 637
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1887 Sequence: atggattcgggtagcagcagcagcgactcggcgcccgattgctgggaccaggtggacatggaatccacggggtcggccccgagcggggatggagtctcctctgcggtggccgaggcccagcgcgagcccctcagctcggctttcagccgtaagctcaacgtcaacgccaagccct Show more
Description: A cloning plasmid for the GSPT2 gene.

GSPT2 Rabbit pAb
A4578-100ul	Abclonal	100 ul	EUR 308

GSPT2 Rabbit pAb
A4578-200ul	Abclonal	200 ul	EUR 459

GSPT2 Rabbit pAb
A4578-20ul	Abclonal	20 ul	Ask for price

GSPT2 Rabbit pAb
A4578-50ul	Abclonal	50 ul	Ask for price

anti- GSPT2 antibody
FNab03681	FN Test	100µg	EUR 505.25
Immunogen: G1 to S phase transition 2 Uniprot ID: Q8IYD1 Gene ID: 23708 Research Area: Metabolism
Description: Antibody raised against GSPT2

Anti-GSPT2 antibody
PAab03681	Lifescience Market	100 ug	EUR 355

Anti-GSPT2 antibody
STJ26738	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a GTPase that belongs to the GTP-binding elongation factor family. The encoded protein is a polypeptide release factor that complexes with eukaryotic peptide chain release factor 1 to mediate translation termination. This protein may also be involved in mRNA stability.

Human GSPT2 ELISA KIT
ELI-09714h	Lifescience Market	96 Tests	EUR 824

Mouse Gspt2 ELISA KIT
ELI-10024m	Lifescience Market	96 Tests	EUR 865

GSPT2 ELISA KIT|Human
EF010012	Lifescience Market	96 Tests	EUR 689

Human GSPT2 shRNA Plasmid
20-abx958439	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GSPT2 shRNA Plasmid
20-abx970683	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSPT2 Recombinant Protein (Human)
RP014092	ABM	100 ug	Ask for price

GSPT2 Recombinant Protein (Rat)
RP203819	ABM	100 ug	Ask for price

GSPT2 Recombinant Protein (Mouse)
RP140222	ABM	100 ug	Ask for price

Gspt2 ORF Vector (Rat) (pORF)
ORF067941	ABM	1.0 ug DNA	EUR 506

GSPT2 ORF Vector (Human) (pORF)
ORF004698	ABM	1.0 ug DNA	EUR 95

Gspt2 ORF Vector (Mouse) (pORF)
ORF046742	ABM	1.0 ug DNA	EUR 506

Gspt2 sgRNA CRISPR Lentivector set (Rat)
K6317501	ABM	3 x 1.0 ug	EUR 339

Gspt2 sgRNA CRISPR Lentivector set (Mouse)
K4000301	ABM	3 x 1.0 ug	EUR 339

GSPT2 sgRNA CRISPR Lentivector set (Human)
K0912301	ABM	3 x 1.0 ug	EUR 339

Gspt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6317502	ABM	1.0 ug DNA	EUR 154

Gspt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6317503	ABM	1.0 ug DNA	EUR 154

Gspt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6317504	ABM	1.0 ug DNA	EUR 154

Gspt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4000302	ABM	1.0 ug DNA	EUR 154

Gspt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4000303	ABM	1.0 ug DNA	EUR 154

Gspt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4000304	ABM	1.0 ug DNA	EUR 154

GSPT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0912302	ABM	1.0 ug DNA	EUR 154

GSPT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0912303	ABM	1.0 ug DNA	EUR 154

GSPT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0912304	ABM	1.0 ug DNA	EUR 154

GSPT2 Protein Vector (Rat) (pPB-C-His)
PV271762	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Rat) (pPB-N-His)
PV271763	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Rat) (pPM-C-HA)
PV271764	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Rat) (pPM-C-His)
PV271765	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Mouse) (pPB-C-His)
PV186966	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Mouse) (pPB-N-His)
PV186967	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Mouse) (pPM-C-HA)
PV186968	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Mouse) (pPM-C-His)
PV186969	ABM	500 ng	EUR 603

GSPT2 Protein Vector (Human) (pPB-C-His)
PV018789	ABM	500 ng	EUR 329

GSPT2 Protein Vector (Human) (pPB-N-His)
PV018790	ABM	500 ng	EUR 329

GSPT2 Protein Vector (Human) (pPM-C-HA)
PV018791	ABM	500 ng	EUR 329

GSPT2 Protein Vector (Human) (pPM-C-His)
PV018792	ABM	500 ng	EUR 329

Gspt2 3'UTR Luciferase Stable Cell Line
TU109168	ABM	1.0 ml	Ask for price

Gspt2 3'UTR Luciferase Stable Cell Line
TU205507	ABM	1.0 ml	Ask for price

Gspt2 3'UTR GFP Stable Cell Line
TU159168	ABM	1.0 ml	Ask for price

Gspt2 3'UTR GFP Stable Cell Line
TU255507	ABM	1.0 ml	Ask for price

GSPT2 3'UTR GFP Stable Cell Line
TU059375	ABM	1.0 ml	EUR 1394