Human DIAPH1(Diaphanous Homolog 1) ELISA Kit

Contents

Human DIAPH1(Diaphanous Homolog 1) ELISA Kit 

Order Now: lieven@gentaur.com

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
DLR-DIAPH1-Hu-96T 96T
EUR 673
  • Should the Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from tissue homogenates or other biological fluids.
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RDR-DIAPH1-Hu-48Tests 48 Tests
EUR 544
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RDR-DIAPH1-Hu-96Tests 96 Tests
EUR 756
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RD-DIAPH1-Hu-48Tests 48 Tests
EUR 521
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RD-DIAPH1-Hu-96Tests 96 Tests
EUR 723
Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit
201-12-2655 96 tests
EUR 440
  • This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Diaphanous Homolog 1(DIAPH1)ELISA Kit
QY-E04979 96T
EUR 374
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
4-SEJ265Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diaphanous Homolog 1 elisa. Alternative names of the recognized antigen: DFNA1
  • DRF1
  • LFHL1
  • hDIA1
  • Diaphanous-related formin-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Diaphanous Homolog 1 (DIAPH1) Antibody
20-abx112060
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diaphanous Homolog 1 (DIAPH1) Antibody
20-abx130946
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Diaphanous Homolog 1 (DIAPH1) Antibody
20-abx172111
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Diaphanous Homolog 1 (DIAPH1)
4-RPJ265Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.5kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Diaphanous Homolog 1 expressed in: E.coli
Human Diaphanous Homolog 1 (DIAPH1) Protein
20-abx168221
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) ELISA Kit
20-abx151314
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT
ELI-08272h 96 Tests
EUR 824
ELISA kit for Human DIAPH1 (Diaphanous Homolog 1)
ELK3618 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diaphanous Homolog 1 (DIAPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diap
  • Show more
Description: A sandwich ELISA kit for detection of Diaphanous Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody
20-abx004420
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody
abx122868-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody
abx431205-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Mouse Protein diaphanous homolog 1, Diaph1 ELISA KIT
ELI-26053m 96 Tests
EUR 865
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human)
4-PAJ265Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1)
Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) CLIA Kit
20-abx495656
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-48T 48T
EUR 332
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-96T 96T
EUR 539
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)
KTE71284-48T 48T
EUR 332
  • Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)
KTE71284-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)
KTE71284-96T 96T
EUR 539
  • Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC
4-PAJ265Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Biotinylated
4-PAJ265Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Biotin.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Cy3
4-PAJ265Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Cy3.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), FITC
4-PAJ265Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with FITC.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), HRP
4-PAJ265Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with HRP.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), PE
4-PAJ265Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with PE.
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC-Cy7
4-PAJ265Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC-Cy7.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human Protein diaphanous homolog 3, DIAPH3 ELISA KIT
ELI-08892h 96 Tests
EUR 824
Human Diaphanous Homolog 3 (Drosophila) (DIAPH3) ELISA Kit
abx386886-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein diaphanous homolog 2, DIAPH2 ELISA KIT
ELI-32025h 96 Tests
EUR 824
ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)
KTE62059-48T 48T
EUR 332
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)
KTE62059-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)
KTE62059-96T 96T
EUR 539
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)
KTE62060-48T 48T
EUR 332
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)
KTE62060-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)
KTE62060-96T 96T
EUR 539
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Protein diaphanous homolog 3, Diaph3 ELISA KIT
ELI-09193m 96 Tests
EUR 865
Mouse Protein diaphanous homolog 2, Diaph2 ELISA KIT
ELI-26818m 96 Tests
EUR 865
ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)
KTE71282-48T 48T
EUR 332
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)
KTE71282-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)
KTE71282-96T 96T
EUR 539
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)
KTE71283-48T 48T
EUR 332
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)
KTE71283-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)
KTE71283-96T 96T
EUR 539
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
DIAPH1 ELISA Kit (Human) (OKCD09173)
OKCD09173 96 Wells
EUR 975
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL
DIAPH1 ELISA Kit (Human) (OKDD00229)
OKDD00229 96 Wells
EUR 975
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL
DIAPH1 ELISA Kit (Human) (OKEH08375)
OKEH08375 96 Wells
EUR 896
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098ng/mL
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx003832
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx112061
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx125761
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx028919-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx028919-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx432603-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx301045
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx232386-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (HRP)
20-abx315532
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (FITC)
20-abx315533
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (Biotin)
20-abx315534
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DIAPH1 antibody
70R-12637 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DIAPH1 antibody
DIAPH1 antibody
70R-21513 50 ul
EUR 435
Description: Rabbit polyclonal DIAPH1 antibody
DIAPH1 Antibody
33034-100ul 100ul
EUR 252
DIAPH1 Antibody
33105-100ul 100ul
EUR 252
DIAPH1 Antibody
49974-100ul 100ul
EUR 333
DIAPH1 Antibody
49974-50ul 50ul
EUR 239
DIAPH1 Antibody
1-CSB-PA006890GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DIAPH1. Recognizes DIAPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
DIAPH1 siRNA
20-abx914148
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DIAPH1 siRNA
20-abx914149
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-DIAPH1
YF-PA11357 50 ul
EUR 363
Description: Mouse polyclonal to DIAPH1
anti-DIAPH1
YF-PA11358 50 ug
EUR 363
Description: Mouse polyclonal to DIAPH1
anti-DIAPH1
YF-PA11359 100 ug
EUR 403
Description: Rabbit polyclonal to DIAPH1
anti-DIAPH1
YF-PA23588 50 ul
EUR 334
Description: Mouse polyclonal to DIAPH1
Human DIAPH1 shRNA Plasmid
20-abx951198
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
DIAPH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0602102 1.0 ug DNA
EUR 154
DIAPH1 Rabbit mAb
A11596-100ul 100 ul
EUR 410
DIAPH1 Rabbit mAb
A11596-200ul 200 ul
EUR 571
DIAPH1 Rabbit mAb
A11596-20ul 20 ul
EUR 221
DIAPH1 Rabbit mAb
A11596-50ul 50 ul
EUR 287
DIAPH1 Conjugated Antibody
C49974 100ul
EUR 397
DIAPH1 Conjugated Antibody
C33034 100ul
EUR 397
DIAPH1 cloning plasmid
CSB-CL006890HU-10ug 10ug
EUR 1333
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3789
  • Sequence: atggagccgcccggcgggagcctggggcccggccgcgggacccgggacaagaagaagggccggagcccagatgagctgccctcggcgggcggcgacggcggcaaatctaagaaatttctggagagatttaccagcatgagaattaagaaggagaaggaaaagcccaattctgctc
  • Show more
Description: A cloning plasmid for the DIAPH1 gene.
DIAPH1 Rabbit pAb
A5772-100ul 100 ul
EUR 308
DIAPH1 Rabbit pAb
A5772-200ul 200 ul
EUR 459
DIAPH1 Rabbit pAb
A5772-20ul 20 ul
EUR 183
DIAPH1 Rabbit pAb
A5772-50ul 50 ul
EUR 223
Anti-DIAPH1 antibody
STJ11100054 100 µl
EUR 413
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.
Anti-DIAPH1 antibody
STJ28339 100 µl
EUR 277
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.
Anti-DIAPH1 antibody
STJ71749 100 µg
EUR 359
Anti-DIAPH1 (5A8)
YF-MA12678 100 ug
EUR 363
Description: Mouse monoclonal to DIAPH1
Anti-DIAPH1 (1A8)
YF-MA12679 100 ug
EUR 363
Description: Mouse monoclonal to DIAPH1
DIAPH1 ORF Vector (Human) (pORF)
ORF012840 1.0 ug DNA
EUR 354
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human Notch Homolog 1 ELISA kit
E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Notch Homolog 1 ELISA kit
E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Notch Homolog 1 ELISA kit
E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
DIAPH1 Polyclonal Conjugated Antibody
C30293 100ul
EUR 397
Mouse DIAPH1 shRNA Plasmid
20-abx970001
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
DIAPH1 sgRNA CRISPR Lentivector set (Human)
K0602101 3 x 1.0 ug
EUR 339
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1 96 Well Plate
EUR 477
Human Complexin-1 AssayMax ELISA Kit
EC3505-1 96 Well Plate
EUR 417
Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1 96 Well Plate
EUR 417
Human Frizzled Homolog 1 (FZD1)ELISA Kit
201-12-2369 96 tests
EUR 440
  • This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Slit Homolog 1 (Slit1)ELISA Kit
201-12-2565 96 tests
EUR 440
  • This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Disabled Homolog 1 (DAB1)ELISA Kit
201-12-2657 96 tests
EUR 440
  • This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Atonal Homolog 1 (ATOH1)ELISA Kit
201-12-2838 96 tests
EUR 440
  • This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Chromobox Homolog 1 (CBX1)ELISA Kit
201-12-2894 96 tests
EUR 440
  • This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-48T 48T
EUR 517
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.
Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-96T 96T
EUR 673
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.
Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-48T 48T
EUR 517
  • Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-96T 96T
EUR 673
  • Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Snail Homolog 1 (SNAI1) ELISA Kit
DLR-SNAI1-Hu-48T 48T
EUR 517
  • Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Snail Homolog 1 (SNAI1) ELISA Kit
DLR-SNAI1-Hu-96T 96T
EUR 673
  • Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-48T 48T
EUR 517
  • Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.
Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-96T 96T
EUR 673
  • Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-48T 48T
EUR 517
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-96T 96T
EUR 673
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-48T 48T
EUR 517
  • Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-96T 96T
EUR 673
  • Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.
Human Roundabout homolog 1(ROBO1) ELISA kit
CSB-EL020054HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Roundabout homolog 1(ROBO1) ELISA kit
1-CSB-EL020054HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1(ROBO1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human DAB1/ Disabled homolog 1 ELISA Kit
E0654Hu 1 Kit
EUR 605
Human Achaete scute homolog 1 ELISA kit
E01A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Achaete scute homolog 1 ELISA kit
E01A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protein pellino homolog 1 ELISA kit
E01P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protein pellino homolog 1 ELISA kit
E01P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protein pellino homolog 1 ELISA kit
E01P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx054998-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Dickkopf 1 Homolog (DKK1) ELISA Kit
20-abx151322
  • EUR 6642.00
  • EUR 441.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 24 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
20-abx151586
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human MutL Homolog 1 (MLH1) ELISA Kit
20-abx152407
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Pescadillo Homolog 1 (PES1) ELISA Kit
20-abx152717
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Slingshot Homolog 1 (SSH1) ELISA Kit
20-abx153111
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Slit Homolog 1 (Slit1) ELISA Kit
20-abx153114
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Snail Homolog 1 (SNAI1) ELISA Kit
20-abx153126
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx250378-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
abx250519-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Ovostatin homolog 1 (OVOS1) ELISA Kit
abx251879-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
ELISA kit for Human Ovostatin homolog 1
EK5036 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human OVOS1(Ovostatin homolog 1) ELISA Kit
EH2509 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q6IE37
  • Alias: OVOS1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml
ELISA kit for Human Disabled homolog 1
EK3039 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Roundabout homolog 1
EK4583 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human OVOS1/ Ovostatin homolog 1 ELISA Kit
E1844Hu 1 Kit
EUR 605
Human ROBO1/ Roundabout homolog 1 ELISA Kit
E2165Hu 1 Kit
EUR 605
Human DAB1(Disabled homolog 1) ELISA Kit
EH1419 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: O75553
  • Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Pumilio homolog 1, PUM1 ELISA KIT
ELI-15545h 96 Tests
EUR 824
Human Pygopus homolog 1, PYGO1 ELISA KIT
ELI-16773h 96 Tests
EUR 824
Human Dachshund homolog 1, DACH1 ELISA KIT
ELI-09038h 96 Tests
EUR 824
Human Nanos homolog 1, NANOS1 ELISA KIT
ELI-20656h 96 Tests
EUR 824
Human Disabled homolog 1, DAB1 ELISA KIT
ELI-04118h 96 Tests
EUR 824
Human Dapper homolog 1, DACT1 ELISA KIT
ELI-26384h 96 Tests
EUR 824
Human Teashirt homolog 1, TSHZ1 ELISA KIT
ELI-51216h 96 Tests
EUR 824
Human Roundabout homolog 1, ROBO1 ELISA KIT
ELI-53163h 96 Tests
EUR 824
Human Nitrilase homolog 1 (NIT1) ELISA Kit
abx381810-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Notchless Homolog 1 (NLE1) ELISA Kit
abx381821-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dachshund Homolog 1 (DACH1) ELISA Kit
abx556324-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Human Roundabout homolog 1 (ROBO1) ELISA Kit
abx556329-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
abx571378-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx576304-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Chromobox Homolog 1 (CBX1) ELISA Kit
20-abx386315
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Crumbs homolog 1, CRB1 ELISA KIT
ELI-33725h 96 Tests
EUR 824
Human Nitrilase homolog 1, NIT1 ELISA KIT
ELI-39611h 96 Tests
EUR 824
Human Ovostatin homolog 1, OVOS1 ELISA KIT
ELI-37024h 96 Tests
EUR 824
Human Chromobox Homolog 1(CBX1)ELISA Kit
QY-E01796 96T
EUR 361
Human Frizzled Homolog 1(FZD1)ELISA Kit
QY-E02707 96T
EUR 361
Human Slit Homolog 1(Slit1)ELISA Kit
QY-E04588 96T
EUR 361
Human Misato Homolog 1(MSTO1)ELISA Kit
QY-E04795 96T
EUR 361
Human Disabled Homolog 1(DAB1)ELISA Kit
QY-E04976 96T
EUR 361
Human Atonal Homolog 1(ATOH1)ELISA Kit
QY-E05132 96T
EUR 400
Human MutL Homolog 1 ELISA Kit (MLH1)
RK01858 96 Tests
EUR 521
Human Slit Homolog 1 ELISA Kit (Slit1)
RK02297 96 Tests
EUR 521
Human Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Hu-48Tests 48 Tests
EUR 544
Human Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Hu-96Tests 96 Tests
EUR 756
Human Frizzled Homolog 1 (FZD1) ELISA Kit
RDR-FZD1-Hu-48Tests 48 Tests
EUR 544
Human Frizzled Homolog 1 (FZD1) ELISA Kit
RDR-FZD1-Hu-96Tests 96 Tests
EUR 756
Human Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Hu-48Tests 48 Tests
EUR 521
Human Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Hu-96Tests 96 Tests
EUR 723
Human Snail Homolog 1 (SNAI1) ELISA Kit
RD-SNAI1-Hu-48Tests 48 Tests
EUR 521
Human Snail Homolog 1 (SNAI1) ELISA Kit
RD-SNAI1-Hu-96Tests 96 Tests
EUR 723
Human Slingshot Homolog 1 (SSH1) ELISA Kit
RD-SSH1-Hu-48Tests 48 Tests
EUR 521
Human Slingshot Homolog 1 (SSH1) ELISA Kit
RD-SSH1-Hu-96Tests 96 Tests
EUR 723
Human Frizzled Homolog 1 (FZD1) ELISA Kit
SEE571Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Frizzled Homolog 1 (FZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Frizzled Homolog 1 (FZD1) in Tissue homogenates and other biological fluids.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
SEE571Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Frizzled Homolog 1 (FZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Frizzled Homolog 1 (FZD1) in Tissue homogenates and other biological fluids.