GNG12

GNG12 siRNA

20-abx918190
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG12 siRNA

20-abx918191
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG12 antibody

70R-51389 100 ul
EUR 244
Description: Purified Polyclonal GNG12 antibody

GNG12 Antibody

46003-100ul 100ul
EUR 252

GNG12 Antibody

46003-50ul 50ul
EUR 187

GNG12 Antibody

DF9556 200ul
EUR 304
Description: GNG12 Antibody detects endogenous levels of total GNG12.

GNG12 Antibody

1-CSB-PA883362OA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNG12 Conjugated Antibody

C46003 100ul
EUR 397

GNG12 Blocking Peptide

20-abx064264
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human GNG12 Antibody

32775-05111 150 ug
EUR 261

GNG12 cloning plasmid

CSB-CL883362HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 219
  • Sequence: atgtccagcaaaacagcaagcaccaacaatatagcccaggcaaggagaactgtgcagcagttaagattagaagcctccattgaaggaataaaggtttcgaaggcatcagcggacctcatgtcctactgtgaggaacatgccaggagtgaccctttgctgataggaataccaacttc
  • Show more
Description: A cloning plasmid for the GNG12 gene.

GNG12 Blocking Peptide

DF9556-BP 1mg
EUR 195

Mouse Gng12 ELISA KIT

ELI-27207m 96 Tests
EUR 865

Human GNG12 ELISA KIT

ELI-47373h 96 Tests
EUR 824

Bovine GNG12 ELISA KIT

ELI-32426b 96 Tests
EUR 928

GNG12 protein (His tag)

80R-4135 100 ug
EUR 327
Description: Recombinant Human GNG12 protein (His tag)

Mouse GNG12 shRNA Plasmid

20-abx970595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG12 shRNA Plasmid

20-abx961028
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG12 Antibody, HRP conjugated

1-CSB-PA883362OB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG12 Antibody, FITC conjugated

1-CSB-PA883362OC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG12 Antibody, Biotin conjugated

1-CSB-PA883362OD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GNG12. Recognizes GNG12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG12 Recombinant Protein (Human)

RP013540 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139001 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139004 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139007 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139010 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139013 100 ug Ask for price

GNG12 Recombinant Protein (Mouse)

RP139016 100 ug Ask for price

Polyclonal GNG12 Antibody (C-Term)

APR04951G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG12 (C-Term). This antibody is tested and proven to work in the following applications:

Human GNG12 Antibody (Biotin Conjugate)

32775-05121 150 ug
EUR 369

Human GNG12 Antibody (APC Conjguate)

32775-05161 150 ug
EUR 428

GNG12 ORF Vector (Human) (pORF)

ORF004514 1.0 ug DNA
EUR 95

Gng12 ORF Vector (Mouse) (pORF)

ORF046335 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046336 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046337 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046338 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046339 1.0 ug DNA
EUR 506

Gng12 ORF Vector (Mouse) (pORF)

ORF046340 1.0 ug DNA
EUR 506

GNG12 sgRNA CRISPR Lentivector set (Human)

K0877901 3 x 1.0 ug
EUR 339

Human GNG12 AssayLite Antibody (FITC Conjugate)

32775-05141 150 ug
EUR 428

Human GNG12 AssayLite Antibody (RPE Conjugate)

32775-05151 150 ug
EUR 428

Human GNG12 AssayLite Antibody (PerCP Conjugate)

32775-05171 150 ug
EUR 471

Gng12 sgRNA CRISPR Lentivector set (Mouse)

K4904001 3 x 1.0 ug
EUR 339

GNG12 sgRNA CRISPR Lentivector (Human) (Target 1)

K0877902 1.0 ug DNA
EUR 154

GNG12 sgRNA CRISPR Lentivector (Human) (Target 2)

K0877903 1.0 ug DNA
EUR 154

GNG12 sgRNA CRISPR Lentivector (Human) (Target 3)

K0877904 1.0 ug DNA
EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4904002 1.0 ug DNA
EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4904003 1.0 ug DNA
EUR 154

Gng12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4904004 1.0 ug DNA
EUR 154

GNG12 Protein Vector (Mouse) (pPB-C-His)

PV185338 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)

PV185339 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)

PV185340 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-His)

PV185341 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-C-His)

PV185342 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)

PV185343 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)

PV185344 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-His)

PV185345 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-C-His)

PV185346 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPB-N-His)

PV185347 500 ng
EUR 603

GNG12 Protein Vector (Mouse) (pPM-C-HA)

PV185348 500 ng
EUR 603