EXOC8

EXOC8 siRNA

20-abx901800
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC8 siRNA

20-abx915812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC8 siRNA

20-abx915813
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC8 antibody

70R-4492 50 ug
EUR 467
Description: Rabbit polyclonal EXOC8 antibody raised against the N terminal of EXOC8

EXOC8 cloning plasmid

CSB-CL007887HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2166
  • Sequence: atgtcggacagtggggcgagccgcctgcgtcggcagctggagtcagggggttttgaggcgcggctgtacgtgaagcagctctcgcagcagtcggatggggaccgggacctccaggagcaccggcagcgcatccaggcgctggcggaggagacggcgcagaacctgaagcgcaacg
  • Show more
Description: A cloning plasmid for the EXOC8 gene.

EXOC8 Blocking Peptide

33R-5702 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC8 antibody, catalog no. 70R-4492

Mouse EXOC8 shRNA Plasmid

20-abx979520
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EXOC8 shRNA Plasmid

20-abx987896
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EXOC8 shRNA Plasmid

20-abx965613
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC8 Recombinant Protein (Human)

RP011056 100 ug Ask for price

EXOC8 Recombinant Protein (Rat)

RP200105 100 ug Ask for price

EXOC8 Recombinant Protein (Mouse)

RP132494 100 ug Ask for price

EXOC8 ORF Vector (Human) (pORF)

ORF003686 1.0 ug DNA
EUR 95

Exoc8 ORF Vector (Rat) (pORF)

ORF066703 1.0 ug DNA
EUR 506

Exoc8 ORF Vector (Mouse) (pORF)

ORF044166 1.0 ug DNA
EUR 506

EXOC8 sgRNA CRISPR Lentivector set (Human)

K0703101 3 x 1.0 ug
EUR 339

Exoc8 sgRNA CRISPR Lentivector set (Mouse)

K3234101 3 x 1.0 ug
EUR 339

Exoc8 sgRNA CRISPR Lentivector set (Rat)

K7305201 3 x 1.0 ug
EUR 339

EXOC8 sgRNA CRISPR Lentivector (Human) (Target 1)

K0703102 1.0 ug DNA
EUR 154

EXOC8 sgRNA CRISPR Lentivector (Human) (Target 2)

K0703103 1.0 ug DNA
EUR 154

EXOC8 sgRNA CRISPR Lentivector (Human) (Target 3)

K0703104 1.0 ug DNA
EUR 154

Exoc8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3234102 1.0 ug DNA
EUR 154

Exoc8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3234103 1.0 ug DNA
EUR 154

Exoc8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3234104 1.0 ug DNA
EUR 154

Exoc8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7305202 1.0 ug DNA
EUR 154

Exoc8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7305203 1.0 ug DNA
EUR 154

Exoc8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7305204 1.0 ug DNA
EUR 154

EXOC8 Protein Vector (Mouse) (pPB-C-His)

PV176662 500 ng
EUR 1065

EXOC8 Protein Vector (Mouse) (pPB-N-His)

PV176663 500 ng
EUR 1065

EXOC8 Protein Vector (Mouse) (pPM-C-HA)

PV176664 500 ng
EUR 1065

EXOC8 Protein Vector (Mouse) (pPM-C-His)

PV176665 500 ng
EUR 1065

EXOC8 Protein Vector (Human) (pPB-C-His)

PV014741 500 ng
EUR 329

EXOC8 Protein Vector (Human) (pPB-N-His)

PV014742 500 ng
EUR 329

EXOC8 Protein Vector (Human) (pPM-C-HA)

PV014743 500 ng
EUR 329

EXOC8 Protein Vector (Human) (pPM-C-His)

PV014744 500 ng
EUR 329

EXOC8 Protein Vector (Rat) (pPB-C-His)

PV266810 500 ng
EUR 1166

EXOC8 Protein Vector (Rat) (pPB-N-His)

PV266811 500 ng
EUR 1166

EXOC8 Protein Vector (Rat) (pPM-C-HA)

PV266812 500 ng
EUR 1166

EXOC8 Protein Vector (Rat) (pPM-C-His)

PV266813 500 ng
EUR 1166

Exoc8 3'UTR Luciferase Stable Cell Line

TU204156 1.0 ml Ask for price

Exoc8 3'UTR GFP Stable Cell Line

TU156014 1.0 ml Ask for price

EXOC8 3'UTR Luciferase Stable Cell Line

TU007127 1.0 ml
EUR 1521

Exoc8 3'UTR Luciferase Stable Cell Line

TU106014 1.0 ml Ask for price

EXOC8 3'UTR GFP Stable Cell Line

TU057127 1.0 ml
EUR 1521

Exoc8 3'UTR GFP Stable Cell Line

TU254156 1.0 ml Ask for price

Bovine Exocyst complex component 8, EXOC8 ELISA KIT

ELI-09970b 96 Tests
EUR 928

Human Exocyst complex component 8, EXOC8 ELISA KIT

ELI-20568h 96 Tests
EUR 824

Chicken Exocyst complex component 8, EXOC8 ELISA KIT

ELI-27373c 96 Tests
EUR 928

Mouse Exocyst complex component 8, Exoc8 ELISA KIT

ELI-30737m 96 Tests
EUR 865

EXOC8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662245 1.0 ug DNA
EUR 1355

EXOC8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662249 1.0 ug DNA
EUR 1355

EXOC8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662250 1.0 ug DNA
EUR 1355

EXOC8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791569 1.0 ug DNA
EUR 316

EXOC8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791570 1.0 ug DNA
EUR 316

EXOC8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0703105 3 x 1.0 ug
EUR 376

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3234105 3 x 1.0 ug
EUR 376

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7305205 3 x 1.0 ug
EUR 376

EXOC8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0703106 1.0 ug DNA
EUR 167

EXOC8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0703107 1.0 ug DNA
EUR 167

EXOC8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0703108 1.0 ug DNA
EUR 167

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3234106 1.0 ug DNA
EUR 167

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3234107 1.0 ug DNA
EUR 167

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3234108 1.0 ug DNA
EUR 167

EXOC8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV662246 1.0 ug DNA
EUR 1355

EXOC8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV662247 1.0 ug DNA
EUR 1413

EXOC8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV662248 1.0 ug DNA
EUR 1413

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7305206 1.0 ug DNA
EUR 167

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7305207 1.0 ug DNA
EUR 167

Exoc8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7305208 1.0 ug DNA
EUR 167

EXOC8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV791567 1.0 ug DNA
EUR 374