  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP12 antibody
70R-3798 50 ug
EUR 467
Description: Rabbit polyclonal USP12 antibody raised against the middle region of USP12
USP12 antibody
70R-21192 50 ul
EUR 435
Description: Rabbit polyclonal USP12 antibody
USP12 Antibody
39921-100ul 100ul
EUR 390
USP12 Antibody
46696-100ul 100ul
EUR 252
USP12 Antibody
DF9981 200ul
EUR 304
Description: USP12 Antibody detects endogenous levels of total USP12.
USP12 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
USP12 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000
YF-PA22718 50 ug
EUR 363
Description: Mouse polyclonal to USP12
YF-PA26974 50 ul
EUR 334
Description: Mouse polyclonal to USP12
USP12 Conjugated Antibody
C46696 100ul
EUR 397
USP12 cloning plasmid
CSB-CL025699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1113
  • Sequence: atggaaatcctaatgacagtctccaaattcgcctccatctgtaccatgggcgccaatgcttcggcattagagaaagagattggtccagaacagtttccggtcaatgagcactattttggattagtcaattttgggaatacctgctactgcaattcagttcttcaagcactttatt
  • Show more
Description: A cloning plasmid for the USP12 gene.
anti- USP12 antibody
FNab09307 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: ubiquitin specific peptidase 12
  • Uniprot ID: O75317
  • Gene ID: 219333
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP12
USP12 / USP46 Antibody
abx031548-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
USP12 / USP46 Antibody
abx031548-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
USP12 Polyclonal Antibody
A50588 100 µg
EUR 570.55
Description: kits suitable for this type of research
USP12 Rabbit pAb
A5201-100ul 100 ul
EUR 308
USP12 Rabbit pAb
A5201-200ul 200 ul
EUR 459
USP12 Rabbit pAb
A5201-20ul 20 ul Ask for price
USP12 Rabbit pAb
A5201-50ul 50 ul Ask for price
USP12 Rabbit pAb
A17862-100ul 100 ul
EUR 308
USP12 Rabbit pAb
A17862-200ul 200 ul
EUR 459
USP12 Rabbit pAb
A17862-20ul 20 ul
EUR 183
USP12 Rabbit pAb
A17862-50ul 50 ul
EUR 223
USP12 Blocking Peptide
33R-4187 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP12 antibody, catalog no. 70R-3798
USP12 Blocking Peptide
DF9981-BP 1mg
EUR 195
Anti-USP12 antibody
PAab09307 100 ug
EUR 386
Anti-USP12 antibody
STJ27177 100 µl
EUR 277
Anti-USP12 antibody
STJ119874 100 µl
EUR 277
EF004116 96 Tests
EUR 689
ELI-28634b 96 Tests
EUR 928
Human USP12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse USP12 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP12 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP12 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP12 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
USP12 Recombinant Protein (Human)
RP034078 100 ug Ask for price
USP12 Recombinant Protein (Rat)
RP236036 100 ug Ask for price
USP12 Recombinant Protein (Mouse)
RP183326 100 ug Ask for price
USP12 Polyclonal Antibody, HRP Conjugated
A50589 100 µg
EUR 570.55
Description: fast delivery possible
USP12 Polyclonal Antibody, FITC Conjugated
A50590 100 µg
EUR 570.55
Description: reagents widely cited
USP12 Polyclonal Antibody, Biotin Conjugated
A50591 100 µg
EUR 570.55
Description: Ask the seller for details
Usp12 ORF Vector (Rat) (pORF)
ORF078680 1.0 ug DNA
EUR 506
USP12 ORF Vector (Human) (pORF)
ORF011360 1.0 ug DNA
EUR 95
Usp12 ORF Vector (Mouse) (pORF)
ORF061110 1.0 ug DNA
EUR 506
Polyclonal Usp12 Antibody - N-terminal region
APR01295G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Usp12 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal USP12/USP46 Antibody (C-term)
APR04819G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP12/USP46 (C-term). This antibody is tested and proven to work in the following applications:
Ubiquitin Specific Peptidase 12 (USP12) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
USP12 sgRNA CRISPR Lentivector set (Human)
K2597901 3 x 1.0 ug
EUR 339
Usp12 sgRNA CRISPR Lentivector set (Rat)
K6248901 3 x 1.0 ug
EUR 339
Usp12 sgRNA CRISPR Lentivector set (Mouse)
K4993201 3 x 1.0 ug
EUR 339
USP12-AS1 ORF Vector (Human) (pORF)
ORF035554 1.0 ug DNA Ask for price
USP12-AS2 ORF Vector (Human) (pORF)
ORF035555 1.0 ug DNA Ask for price
Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
abx036644-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
abx219269-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
abx239307-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
USP12 sgRNA CRISPR Lentivector (Human) (Target 1)
K2597902 1.0 ug DNA
EUR 154
USP12 sgRNA CRISPR Lentivector (Human) (Target 2)
K2597903 1.0 ug DNA
EUR 154
USP12 sgRNA CRISPR Lentivector (Human) (Target 3)
K2597904 1.0 ug DNA
EUR 154
Usp12 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6248902 1.0 ug DNA
EUR 154
Usp12 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6248903 1.0 ug DNA
EUR 154
Usp12 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6248904 1.0 ug DNA
EUR 154
Usp12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4993202 1.0 ug DNA
EUR 154
Usp12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4993203 1.0 ug DNA
EUR 154
Usp12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4993204 1.0 ug DNA
EUR 154
USP12 Protein Vector (Human) (pPB-C-His)
PV045437 500 ng
EUR 329
USP12 Protein Vector (Human) (pPB-N-His)
PV045438 500 ng
EUR 329
USP12 Protein Vector (Human) (pPM-C-HA)
PV045439 500 ng
EUR 329
USP12 Protein Vector (Human) (pPM-C-His)
PV045440 500 ng
EUR 329
USP12 Protein Vector (Rat) (pPB-C-His)
PV314718 500 ng
EUR 603
USP12 Protein Vector (Rat) (pPB-N-His)
PV314719 500 ng
EUR 603
USP12 Protein Vector (Rat) (pPM-C-HA)
PV314720 500 ng
EUR 603