USP12 Antibody
46696-100ul	SAB	100ul	EUR 252

USP12 Antibody
39921-100ul	SAB	100ul	EUR 390

USP12 Antibody
DF9981	Affbiotech	200ul	EUR 304
Description: USP12 Antibody detects endogenous levels of total USP12.

USP12 Antibody
1-CSB-PA025699GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

USP12 Antibody
1-CSB-PA025699LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

USP12 antibody
70R-3798	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal USP12 antibody raised against the middle region of USP12

USP12 siRNA
20-abx939149	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP12 siRNA
20-abx939150	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP12 Antibody
ABD9981	Lifescience Market	100 ug	EUR 438

anti-USP12
YF-PA22718	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to USP12

anti-USP12
YF-PA26974	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to USP12

USP12 Blocking Peptide
33R-4187	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP12 antibody, catalog no. 70R-3798

USP12 Blocking Peptide
DF9981-BP	Affbiotech	1mg	EUR 195

USP12 / USP46 Antibody
abx031548-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

USP12 / USP46 Antibody
abx031548-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

USP12 Conjugated Antibody
C46696	SAB	100ul	EUR 397

USP12 cloning plasmid
CSB-CL025699HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1113 Sequence: atggaaatcctaatgacagtctccaaattcgcctccatctgtaccatgggcgccaatgcttcggcattagagaaagagattggtccagaacagtttccggtcaatgagcactattttggattagtcaattttgggaatacctgctactgcaattcagttcttcaagcactttatt Show more
Description: A cloning plasmid for the USP12 gene.

USP12 Polyclonal Antibody
A50588	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

USP12 Rabbit pAb
A5201-100ul	Abclonal	100 ul	EUR 308

USP12 Rabbit pAb
A5201-200ul	Abclonal	200 ul	EUR 459

USP12 Rabbit pAb
A5201-20ul	Abclonal	20 ul	Ask for price

USP12 Rabbit pAb
A5201-50ul	Abclonal	50 ul	Ask for price

USP12 Rabbit pAb
A17862-100ul	Abclonal	100 ul	EUR 308

USP12 Rabbit pAb
A17862-200ul	Abclonal	200 ul	EUR 459

USP12 Rabbit pAb
A17862-20ul	Abclonal	20 ul	EUR 183

USP12 Rabbit pAb
A17862-50ul	Abclonal	50 ul	EUR 223

anti- USP12 antibody
FNab09307	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 Immunogen: ubiquitin specific peptidase 12 Uniprot ID: O75317 Gene ID: 219333 Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP12

Anti-USP12 antibody
PAab09307	Lifescience Market	100 ug	EUR 386

Anti-USP12 antibody
STJ27177	St John's Laboratory	100 µl	EUR 277

Anti-USP12 antibody
STJ119874	St John's Laboratory	100 µl	EUR 277

USP12 Antibody, HRP conjugated
1-CSB-PA025699LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USP12 Antibody, FITC conjugated
1-CSB-PA025699LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USP12 Antibody, Biotin conjugated
1-CSB-PA025699LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP12. Recognizes USP12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Bovine USP12 ELISA KIT
ELI-28634b	Lifescience Market	96 Tests	EUR 928

USP12 ELISA KIT|Human
EF004116	Lifescience Market	96 Tests	EUR 689

Human USP12 shRNA Plasmid
20-abx966369	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse USP12 shRNA Plasmid
20-abx973293	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

USP12 Recombinant Protein (Rat)
RP236036	ABM	100 ug	Ask for price

USP12 Recombinant Protein (Human)
RP034078	ABM	100 ug	Ask for price

USP12 Recombinant Protein (Mouse)
RP183326	ABM	100 ug	Ask for price

USP12 Polyclonal Antibody, HRP Conjugated
A50589	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

USP12 Polyclonal Antibody, FITC Conjugated
A50590	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

USP12 Polyclonal Antibody, Biotin Conjugated
A50591	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Usp12 ORF Vector (Mouse) (pORF)
ORF061110	ABM	1.0 ug DNA	EUR 506

Usp12 ORF Vector (Rat) (pORF)
ORF078680	ABM	1.0 ug DNA	EUR 506

USP12 ORF Vector (Human) (pORF)
ORF011360	ABM	1.0 ug DNA	EUR 95

Polyclonal USP12/USP46 Antibody (C-term)
APR04819G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP12/USP46 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Usp12 Antibody - N-terminal region
APR01295G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Usp12 - N-terminal region. This antibody is tested and proven to work in the following applications:

Ubiquitin Specific Peptidase 12 (USP12) Antibody
20-abx116426	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Usp12 sgRNA CRISPR Lentivector set (Mouse)
K4993201	ABM	3 x 1.0 ug	EUR 339

Usp12 sgRNA CRISPR Lentivector set (Rat)
K6248901	ABM	3 x 1.0 ug	EUR 339

USP12 sgRNA CRISPR Lentivector set (Human)
K2597901	ABM	3 x 1.0 ug	EUR 339

USP12-AS1 ORF Vector (Human) (pORF)
ORF035554	ABM	1.0 ug DNA	Ask for price

USP12-AS2 ORF Vector (Human) (pORF)
ORF035555	ABM	1.0 ug DNA	Ask for price

Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
20-abx003991	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
abx219269-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
abx036644-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
abx239307-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 12 (USP12) Antibody
20-abx317908	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Usp12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4993202	ABM	1.0 ug DNA	EUR 154

Usp12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4993203	ABM	1.0 ug DNA	EUR 154

Usp12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4993204	ABM	1.0 ug DNA	EUR 154

Usp12 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6248902	ABM	1.0 ug DNA	EUR 154

Usp12 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6248903	ABM	1.0 ug DNA	EUR 154

Usp12 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6248904	ABM	1.0 ug DNA	EUR 154

USP12 sgRNA CRISPR Lentivector (Human) (Target 1)
K2597902	ABM	1.0 ug DNA	EUR 154

USP12 sgRNA CRISPR Lentivector (Human) (Target 2)
K2597903	ABM	1.0 ug DNA	EUR 154

USP12 sgRNA CRISPR Lentivector (Human) (Target 3)
K2597904	ABM	1.0 ug DNA	EUR 154

USP12 Protein Vector (Mouse) (pPB-C-His)
PV244438	ABM	500 ng	EUR 603

USP12 Protein Vector (Mouse) (pPB-N-His)
PV244439	ABM	500 ng	EUR 603

USP12 Protein Vector (Mouse) (pPM-C-HA)
PV244440	ABM	500 ng	EUR 603

USP12 Protein Vector (Mouse) (pPM-C-His)
PV244441	ABM	500 ng	EUR 603

USP12 Protein Vector (Rat) (pPB-C-His)
PV314718	ABM	500 ng	EUR 603

USP12 Protein Vector (Rat) (pPB-N-His)
PV314719	ABM	500 ng	EUR 603

USP12 Protein Vector (Rat) (pPM-C-HA)
PV314720	ABM	500 ng	EUR 603