  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CSF2RA Antibody

ABD4820 100 ug
EUR 438

CSF2RA Antibody

ABD6768 100 ug
EUR 438

CSF2RA Antibody

ABD7224 100 ug
EUR 438

CSF2RA Antibody

35318-100ul 100ul
EUR 252

CSF2RA Antibody

35318-50ul 50ul
EUR 187

CSF2RA antibody

38337-100ul 100ul
EUR 252

CSF2RA antibody

38609-100ul 100ul
EUR 252

CSF2RA antibody

70R-16615 50 ul
EUR 435
Description: Rabbit polyclonal CSF2RA antibody

CSF2RA Antibody

DF4820 200ul
EUR 304
Description: CSF2RA Antibody detects endogenous levels of total CSF2RA.

CSF2RA Antibody

DF6768 200ul
EUR 304
Description: CSF2RA Antibody detects endogenous levels of total CSF2RA.

CSF2RA Antibody

DF7224 200ul
EUR 304
Description: CSF2RA Antibody detects endogenous levels of total CSF2RA.

CSF2RA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CSF2RA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CSF2RA Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CSF2RA Antibody

CSB-PA006046KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CSF2RA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:200-1:500

CSF2RA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CSF2RA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CSF2RA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CSF2RA Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CSF2RA Antibody

CSB-PA046967-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000


PVT17480 2 ug
EUR 231


PVT17481 2 ug
EUR 231

CSF2RA Conjugated Antibody

C35318 100ul
EUR 397

CSF2RA cloning plasmid

CSB-CL006046HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccagagaaatcggatctgcgaacagtggcaccagcctctagtctcaatgtgaggtttgactccaggacgatgaatttaagctgggactgccaagaaaacacaaccttcagca
  • Show more
Description: A cloning plasmid for the CSF2RA gene.

CSF2RA cloning plasmid

CSB-CL006046HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccagagaaatcggatctgcgaacagtggcaccagcctctagtctcaatgtgaggtttgactccaggacgatgaatttaagctgggactgccaagaaaacacaaccttcagca
  • Show more
Description: A cloning plasmid for the CSF2RA gene.

CSF2RA / CD116 Antibody

abx232013-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CSF2RA Polyclonal Antibody

A56976 100 µg
EUR 570.55
Description: The best epigenetics products

CSF2RA Rabbit pAb

A3167-100ul 100 ul
EUR 308

CSF2RA Rabbit pAb

A3167-200ul 200 ul
EUR 459

CSF2RA Rabbit pAb

A3167-20ul 20 ul
EUR 183

CSF2RA Rabbit pAb

A3167-50ul 50 ul
EUR 223

CSF2RA Rabbit pAb

A13181-100ul 100 ul
EUR 308

CSF2RA Rabbit pAb

A13181-200ul 200 ul
EUR 459

CSF2RA Rabbit pAb

A13181-20ul 20 ul
EUR 183

CSF2RA Rabbit pAb

A13181-50ul 50 ul
EUR 223

CSF2RA Rabbit pAb

A2034-100ul 100 ul
EUR 308

CSF2RA Rabbit pAb

A2034-200ul 200 ul
EUR 459

CSF2RA Rabbit pAb

A2034-20ul 20 ul
EUR 183

CSF2RA Rabbit pAb

A2034-50ul 50 ul
EUR 223

CSF2RA Blocking Peptide

DF4820-BP 1mg
EUR 195

CSF2RA Blocking Peptide

DF6768-BP 1mg
EUR 195

CSF2RA Blocking Peptide

DF7224-BP 1mg
EUR 195

Anti-CSF2RA antibody

STJ23237 100 µl
EUR 277
Description: The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble.

Anti-CSF2RA antibody

STJ23238 100 µl
EUR 277
Description: The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble.

Anti-CSF2RA antibody

STJ115147 100 µl
EUR 277
Description: The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble.

CSF2RA Polyclonal Conjugated Antibody

C41669 100ul
EUR 397

Human CSF2Ra ELISA Kit

EHC0592 96Tests
EUR 521


EGTC0592 96Tests
EUR 521

Canine CSF2Ra ELISA Kit

ECC0592 96Tests
EUR 521

Bovine CSF2Ra ELISA Kit

EBC0592 96Tests
EUR 521

Anserini CSF2Ra ELISA Kit

EAC0592 96Tests
EUR 521


ELI-26472h 96 Tests
EUR 824


EF005058 96 Tests
EUR 689

anti- CSF2RA/CD116 antibody

FNab02013 100µg
EUR 505.25
  • Immunogen: colony stimulating factor 2 receptor, alpha, low-affinity(granulocyte-macrophage)
  • Uniprot ID: P15509
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against CSF2RA/CD116

Porcine CSF2Ra ELISA Kit

EPC0592 96Tests
EUR 521


ERC0592 96Tests
EUR 521

Rabbit CSF2Ra ELISA Kit

ERTC0592 96Tests
EUR 521

Mouse Csf2ra ELISA KIT

ELI-32099m 96 Tests
EUR 865

Mouse CSF2Ra ELISA Kit

EMC0592 96Tests
EUR 521

Human CSF2RA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CSF2RA protein (His tag)

80R-3496 100 ug
EUR 327
Description: Purified recombinant CSF2RA protein (His tag)

Mouse CSF2RA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CSF2RA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CSF2RA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CSF2RA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSF2RA. Recognizes CSF2RA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CSF2RA/CD116 antibody

PAab02013 100 ug
EUR 355

Polyclonal CSF2RA Antibody(C-term)

APR15608G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSF2RA (C-term). This antibody is tested and proven to work in the following applications:

Guinea Pig CSF2Ra ELISA Kit

EGC0592 96Tests
EUR 521