PIGM

PIGM antibody

70R-19284 50 ul
EUR 435
Description: Rabbit polyclonal PIGM antibody

PIGM Antibody

1-CSB-PA017976GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PIGM. Recognizes PIGM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PIGM siRNA

20-abx904013
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGM siRNA

20-abx928572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGM siRNA

20-abx928573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PIGM

YF-PA26792 50 ul
EUR 334
Description: Mouse polyclonal to PIGM

PIGM Polyclonal Antibody

30190-100ul 100ul
EUR 252

PIGM Polyclonal Antibody

30190-50ul 50ul
EUR 187

PIGM cloning plasmid

CSB-CL875667HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atgggctccaccaagcactggggcgaatggctcctgaacttgaaggtggctccagccggcgtctttggtgtggcctttctagccagagtcgccctggttttctatggcgtcttccaggaccggaccctgcacgtgaggtatacggacatcgactaccaggtcttcaccgacgccg
  • Show more
Description: A cloning plasmid for the PIGM gene.

PIGM Rabbit pAb

A17811-100ul 100 ul
EUR 308

PIGM Rabbit pAb

A17811-200ul 200 ul
EUR 459

PIGM Rabbit pAb

A17811-20ul 20 ul
EUR 183

PIGM Rabbit pAb

A17811-50ul 50 ul
EUR 223

anti- PIGM antibody

FNab06442 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class M
  • Uniprot ID: Q9H3S5
  • Gene ID: 93183
  • Research Area: Metabolism
Description: Antibody raised against PIGM

Anti-PIGM antibody

PAab06442 100 ug
EUR 386

Anti-PIGM antibody

STJ119837 100 µl
EUR 277
Description: This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI)-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a mannosyltransferase, GPI-MT-I, that transfers the first mannose to GPI on the lumenal side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]

PIGM ELISA KIT|Human

EF001779 96 Tests
EUR 689

Mouse PIGM shRNA Plasmid

20-abx976209
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGM shRNA Plasmid

20-abx964194
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PIGM shRNA Plasmid

20-abx986493
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGM Polyclonal Conjugated Antibody

C30190 100ul
EUR 397

pCMV-SPORT6-PIGM Plasmid

PVT16195 2 ug
EUR 325

PIGM Recombinant Protein (Human)

RP023461 100 ug Ask for price

PIGM Recombinant Protein (Mouse)

RP162044 100 ug Ask for price

PIGM Recombinant Protein (Rat)

RP220481 100 ug Ask for price

Pigm ORF Vector (Rat) (pORF)

ORF073495 1.0 ug DNA
EUR 506

PIGM ORF Vector (Human) (pORF)

ORF007821 1.0 ug DNA
EUR 95

Pigm ORF Vector (Mouse) (pORF)

ORF054016 1.0 ug DNA
EUR 506

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

20-abx114443
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx032299-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx032299-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx236442-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Pigm sgRNA CRISPR Lentivector set (Rat)

K7119501 3 x 1.0 ug
EUR 339

Pigm sgRNA CRISPR Lentivector set (Mouse)

K3485101 3 x 1.0 ug
EUR 339

PIGM sgRNA CRISPR Lentivector set (Human)

K1647701 3 x 1.0 ug
EUR 339

Bovine GPI mannosyltransferase 1, PIGM ELISA KIT

ELI-16385b 96 Tests
EUR 928

Chicken GPI mannosyltransferase 1, PIGM ELISA KIT

ELI-12684c 96 Tests
EUR 928

Human GPI mannosyltransferase 1, PIGM ELISA KIT

ELI-36405h 96 Tests
EUR 824

Mouse GPI mannosyltransferase 1, Pigm ELISA KIT

ELI-36406m 96 Tests
EUR 865

Pigm sgRNA CRISPR Lentivector (Rat) (Target 1)

K7119502 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Rat) (Target 2)

K7119503 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Rat) (Target 3)

K7119504 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3485102 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3485103 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3485104 1.0 ug DNA
EUR 154

PIGM sgRNA CRISPR Lentivector (Human) (Target 1)

K1647702 1.0 ug DNA
EUR 154

PIGM sgRNA CRISPR Lentivector (Human) (Target 2)

K1647703 1.0 ug DNA
EUR 154

PIGM sgRNA CRISPR Lentivector (Human) (Target 3)

K1647704 1.0 ug DNA
EUR 154

PIGM Protein Vector (Rat) (pPB-C-His)

PV293978 500 ng
EUR 603

PIGM Protein Vector (Rat) (pPB-N-His)

PV293979 500 ng
EUR 603

PIGM Protein Vector (Rat) (pPM-C-HA)

PV293980 500 ng
EUR 603

PIGM Protein Vector (Rat) (pPM-C-His)

PV293981 500 ng
EUR 603

PIGM Protein Vector (Human) (pPB-C-His)

PV031281 500 ng
EUR 329

PIGM Protein Vector (Human) (pPB-N-His)

PV031282 500 ng
EUR 329

PIGM Protein Vector (Human) (pPM-C-HA)

PV031283 500 ng
EUR 329