DYNC1H1

DYNC1H1 (DYNC1H1) Antibody

20-abx004533
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

DYNC1H1 (DYNC1H1) Antibody

abx431829-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

DYNC1H1 (DYNC1H1) Antibody

20-abx302288
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYNC1H1 (DYNC1H1) Antibody

abx232582-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit

DLR-DYNC1H1-Hu-48T 48T
EUR 517
  • Should the Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) in samples from tissue homogenates or other biological fluids.

Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit

DLR-DYNC1H1-Hu-96T 96T
EUR 673
  • Should the Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) in samples from tissue homogenates or other biological fluids.

Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit

RDR-DYNC1H1-Hu-48Tests 48 Tests
EUR 544

Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit

RDR-DYNC1H1-Hu-96Tests 96 Tests
EUR 756

Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit

RD-DYNC1H1-Hu-48Tests 48 Tests
EUR 521

Human Dynein, Cytoplasmic 1, Heavy Chain 1 (DYNC1H1) ELISA Kit

RD-DYNC1H1-Hu-96Tests 96 Tests
EUR 723

DYNC1H1 (DYNC1H1) Antibody (HRP)

20-abx316182
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYNC1H1 (DYNC1H1) Antibody (FITC)

20-abx316183
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYNC1H1 (DYNC1H1) Antibody (Biotin)

20-abx316184
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dync1h1/ Rat Dync1h1 ELISA Kit

ELI-26142r 96 Tests
EUR 886

DYNC1H1 siRNA

20-abx901609
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1H1 Antibody

ABD9469 100 ug
EUR 438

DYNC1H1 siRNA

20-abx914797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1H1 siRNA

20-abx914798
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1H1 Antibody

45945-100ul 100ul
EUR 252

DYNC1H1 Antibody

45945-50ul 50ul
EUR 187

DYNC1H1 Antibody

DF9469 200ul
EUR 304
Description: DYNC1H1 Antibody detects endogenous levels of total DYNC1H1.

DYNC1H1 Antibody

1-CSB-PA007292GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DYNC1H1. Recognizes DYNC1H1 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

DYNC1H1 Antibody

1-CSB-PA613491LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1H1. Recognizes DYNC1H1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-DYNC1H1

YF-PA11393 100 ug
EUR 403
Description: Rabbit polyclonal to DYNC1H1

anti-DYNC1H1

YF-PA23595 50 ul
EUR 334
Description: Mouse polyclonal to DYNC1H1

DYNC1H1 Conjugated Antibody

C45945 100ul
EUR 397

DYNC1H1 cloning plasmid

CSB-CL613491HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 594
  • Sequence: atgatcagtaaaatgctgaagatgcagatgttggaggatgaggacgacctggcctacgcagagaccgagaagaagacgaggacagactccacgtccgacgggcgccctgcctggatgcggacactgcacaccaccgcgtccaactggctgcacctcatcccccagacgctgagcca
  • Show more
Description: A cloning plasmid for the DYNC1H1 gene.

anti- DYNC1H1 antibody

FNab02582 100µg
EUR 505.25
  • Immunogen: dynein, cytoplasmic 1, heavy chain 1
  • Uniprot ID: Q14204
  • Research Area: Neuroscience, Cell Division and Proliferation, Developmental biology
Description: Antibody raised against DYNC1H1

DYNC1H1 Rabbit pAb

A5916-100ul 100 ul
EUR 308

DYNC1H1 Rabbit pAb

A5916-200ul 200 ul
EUR 459

DYNC1H1 Rabbit pAb

A5916-20ul 20 ul Ask for price

DYNC1H1 Rabbit pAb

A5916-50ul 50 ul Ask for price

DYNC1H1 Rabbit pAb

A18314-100ul 100 ul
EUR 308

DYNC1H1 Rabbit pAb

A18314-200ul 200 ul
EUR 459

DYNC1H1 Rabbit pAb

A18314-20ul 20 ul
EUR 183

DYNC1H1 Rabbit pAb

A18314-50ul 50 ul
EUR 223

DYNC1H1 Blocking Peptide

DF9469-BP 1mg
EUR 195

Anti-DYNC1H1 antibody

PAab02582 100 ug
EUR 355

Anti-DYNC1H1 antibody

STJ71920 100 µg
EUR 260

Anti-DYNC1H1 antibody

STJ11100270 100 µl
EUR 277
Description: Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family.

Anti-DYNC1H1 antibody

STJ27712 100 µl
EUR 277
Description: Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family.

Rat DYNC1H1 shRNA Plasmid

20-abx985536
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYNC1H1? ELISA KIT|Human

EF009251 96 Tests
EUR 689

Human DYNC1H1 shRNA Plasmid

20-abx951236
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DYNC1H1 shRNA Plasmid

20-abx970029
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYNC1H1 Antibody, HRP conjugated

1-CSB-PA613491LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1H1. Recognizes DYNC1H1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNC1H1 Antibody, FITC conjugated

1-CSB-PA613491LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1H1. Recognizes DYNC1H1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNC1H1 Antibody, Biotin conjugated

1-CSB-PA613491LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1H1. Recognizes DYNC1H1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYNC1H1 ORF Vector (Human) (pORF)

ORF003336 1.0 ug DNA
EUR 95

Dync1h1 ORF Vector (Rat) (pORF)

ORF066291 1.0 ug DNA
EUR 5000

Dync1h1 ORF Vector (Mouse) (pORF)

ORF043458 1.0 ug DNA
EUR 5000

DYNC1H1 ELISA Kit (Human) (OKCD01052)

OKCD01052 96 Wells
EUR 831
Description: Description of target: Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

DYNC1H1 ELISA Kit (Rat) (OKCA01867)

OKCA01867 96 Wells
EUR 846
Description: Description of target: Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL

DYNC1H1 sgRNA CRISPR Lentivector set (Human)

K0643101 3 x 1.0 ug
EUR 339

Dync1h1 sgRNA CRISPR Lentivector set (Mouse)

K3836101 3 x 1.0 ug
EUR 339

Dync1h1 sgRNA CRISPR Lentivector set (Rat)

K6932701 3 x 1.0 ug
EUR 339

DYNC1H1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0643102 1.0 ug DNA
EUR 154

DYNC1H1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0643103 1.0 ug DNA
EUR 154

DYNC1H1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0643104 1.0 ug DNA
EUR 154

Dync1h1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3836102 1.0 ug DNA
EUR 154

Dync1h1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3836103 1.0 ug DNA
EUR 154

Dync1h1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3836104 1.0 ug DNA
EUR 154

Dync1h1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6932702 1.0 ug DNA
EUR 154

Dync1h1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6932703 1.0 ug DNA
EUR 154

Dync1h1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6932704 1.0 ug DNA
EUR 154

DYNC1H1 Protein Vector (Mouse) (pPB-C-His)

PV173830 500 ng
EUR 7325

DYNC1H1 Protein Vector (Mouse) (pPB-N-His)

PV173831 500 ng
EUR 7325

DYNC1H1 Protein Vector (Mouse) (pPM-C-HA)

PV173832 500 ng
EUR 7325

DYNC1H1 Protein Vector (Mouse) (pPM-C-His)

PV173833 500 ng
EUR 7325

DYNC1H1 Protein Vector (Human) (pPB-C-His)

PV013341 500 ng
EUR 329