Human OGN(Osteoglycin) ELISA Kit


Human OGN(Osteoglycin) ELISA Kit 

Order Now:

Human Osteoglycin (OGN) ELISA Kit
DLR-OGN-Hu-96T 96T
EUR 673
  • Should the Human Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Osteoglycin (OGN) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Osteoglycin (OGN) ELISA Kit
RD-OGN-Hu-48Tests 48 Tests
EUR 521
Human Osteoglycin (OGN) ELISA Kit
RD-OGN-Hu-96Tests 96 Tests
EUR 723
Human Osteoglycin (OGN) ELISA Kit
RDR-OGN-Hu-48Tests 48 Tests
EUR 544
Human Osteoglycin (OGN) ELISA Kit
RDR-OGN-Hu-96Tests 96 Tests
EUR 756
Mouse Osteoglycin (OGN) ELISA Kit
DLR-OGN-Mu-48T 48T
EUR 527
  • Should the Mouse Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Osteoglycin (OGN) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Osteoglycin (OGN) ELISA Kit
DLR-OGN-Mu-96T 96T
EUR 688
  • Should the Mouse Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Osteoglycin (OGN) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Osteoglycin (OGN) ELISA Kit
RD-OGN-Mu-48Tests 48 Tests
EUR 533
Mouse Osteoglycin (OGN) ELISA Kit
RD-OGN-Mu-96Tests 96 Tests
EUR 740
Mouse Osteoglycin (OGN) ELISA Kit
RDR-OGN-Mu-48Tests 48 Tests
EUR 557
Mouse Osteoglycin (OGN) ELISA Kit
RDR-OGN-Mu-96Tests 96 Tests
EUR 774
Human Osteoglycin (OGN) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Osteoglycin (OGN) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Osteoglycin elisa. Alternative names of the recognized antigen: OIF
  • SLRR3A
  • Mimecan Proteoglycan
  • Osteoinductive Factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Osteoglycin (OGN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Osteoglycin ELISA Kit (OGN)
RK01988 96 Tests
EUR 521
Human Osteoglycin(OGN)ELISA Kit
QY-E03283 96T
EUR 361
Canine Osteoglycin(OGN)ELISA Kit
GA-E0083CN-48T 48T
EUR 402
Canine Osteoglycin(OGN)ELISA Kit
GA-E0083CN-96T 96T
EUR 684
Mouse Osteoglycin (OGN) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Osteoglycin (OGN) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Osteoglycin elisa. Alternative names of the recognized antigen: OIF
  • SLRR3A
  • Mimecan Proteoglycan
  • Osteoinductive Factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Osteoglycin (OGN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Osteoglycin ELISA Kit (OGN)
RK03091 96 Tests
EUR 521
Osteoglycin (OGN) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Osteoglycin (OGN) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Osteoglycin (OGN) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Osteoglycin (OGN) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Osteoglycin (OGN) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Osteoglycin (OGN)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20774
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.9kDa
  • Isoelectric Point: 9.5
Description: Recombinant Human Osteoglycin expressed in: E.coli
Recombinant Osteoglycin (OGN)
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62000
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Osteoglycin expressed in: E.coli
Recombinant Osteoglycin (OGN)
  • EUR 535.46
  • EUR 246.00
  • EUR 1732.96
  • EUR 644.32
  • EUR 1188.64
  • EUR 421.00
  • EUR 4182.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZVB7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.2kDa
  • Isoelectric Point: 9.6
Description: Recombinant Rat Osteoglycin expressed in: E.coli
Human Osteoglycin / Mimecan (OGN) ELISA Kit
abx572443-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
ELISA kit for Human OGN (Osteoglycin)
E-EL-H2163 1 plate of 96 wells
EUR 534
  • Gentaur's OGN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OGN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OGN (Osteoglycin) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human OGN (Osteoglycin)
ELK3335 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteoglycin (OGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteoglycin (OGN
  • Show more
Description: A sandwich ELISA kit for detection of Osteoglycin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Osteoglycin / Mimecan (OGN) ELISA Kit
abx251775-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Osteoglycin (OGN) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Osteoglycin (OGN) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cow Osteoglycin / Mimecan (OGN) ELISA Kit
abx520882-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Osteoglycin / Mimecan (OGN) ELISA Kit
abx520883-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Osteoglycin / Mimecan (OGN) ELISA Kit
abx571728-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
ELISA kit for Mouse OGN (Osteoglycin)
ELK7069 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteoglycin (OGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteoglycin (OGN
  • Show more
Description: A sandwich ELISA kit for detection of Osteoglycin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Mouse Osteoglycin (OGN) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Osteoglycin (OGN) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Osteoglycin (OGN) Protein
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Osteoglycin (OGN) Antibody (Biotin)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Osteoglycin (OGN) Antibody (Biotin)
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Osteoglycin (OGN) Antibody (Biotin)
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Osteoglycin (OGN) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN)
Osteoglycin (OGN) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN)
Osteoglycin (OGN) Polyclonal Antibody (Rat)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN)
Osteoglycin (OGN) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with APC.
Osteoglycin (OGN) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with Biotin.
Osteoglycin (OGN) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with Cy3.
Osteoglycin (OGN) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with FITC.
Osteoglycin (OGN) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with HRP.
Osteoglycin (OGN) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with PE.
Osteoglycin (OGN) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with APC-Cy7.
Osteoglycin (OGN) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with APC.
Osteoglycin (OGN) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with Biotin.
Osteoglycin (OGN) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with Cy3.
Osteoglycin (OGN) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with FITC.
Osteoglycin (OGN) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with HRP.
Osteoglycin (OGN) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with PE.
Osteoglycin (OGN) Polyclonal Antibody (Rat), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with APC.
Osteoglycin (OGN) Polyclonal Antibody (Rat), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with Biotin.
Osteoglycin (OGN) Polyclonal Antibody (Rat), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with Cy3.
Osteoglycin (OGN) Polyclonal Antibody (Rat), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with FITC.
Osteoglycin (OGN) Polyclonal Antibody (Rat), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with HRP.
Osteoglycin (OGN) Polyclonal Antibody (Rat), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with PE.
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-100ug
QP6449-ec-100ug 100ug
EUR 408
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-10ug
QP6449-ec-10ug 10ug
EUR 200
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-1mg
QP6449-ec-1mg 1mg
EUR 1632
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-200ug
QP6449-ec-200ug 200ug
EUR 634
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-500ug
QP6449-ec-500ug 500ug
EUR 1060
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-50ug
QP6449-ec-50ug 50ug
EUR 263
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-100ug
QP6449-ye-100ug 100ug
EUR 480
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-10ug
QP6449-ye-10ug 10ug
EUR 236
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-1mg
QP6449-ye-1mg 1mg
EUR 1885
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-200ug
QP6449-ye-200ug 200ug
EUR 744
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-500ug
QP6449-ye-500ug 500ug
EUR 1206
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-50ug
QP6449-ye-50ug 50ug
EUR 299
Osteoglycin (OGN) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with APC-Cy7.
Osteoglycin (OGN) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGN (Leu180~Phe298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with APC-Cy7.
Human Osteoglycin ELISA kit
E01O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Osteoglycin ELISA kit
E01O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Osteoglycin ELISA kit
E01O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Osteoglycin ELISA KIT|Human
EF001495 96 Tests
EUR 689
ELA-E8943h 96 Tests
EUR 824
EF006459 96 Tests
EUR 689
Osteoglycin (Osteoglycin) Antibody
abx236032-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Rat Osteoglycin ELISA kit
E02O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Osteoglycin ELISA kit
E02O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Osteoglycin ELISA kit
E02O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Osteoglycin ELISA kit
E03O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Osteoglycin ELISA kit
E03O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Osteoglycin ELISA kit
E03O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Osteoglycin ELISA kit
E04O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Osteoglycin ELISA kit
E04O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Osteoglycin ELISA kit
E04O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Osteoglycin ELISA kit
E06O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Osteoglycin ELISA kit
E06O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Osteoglycin ELISA kit
E06O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Osteoglycin ELISA kit
E07O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Osteoglycin ELISA kit
E07O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Osteoglycin ELISA kit
E07O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Osteoglycin ELISA kit
E08O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Osteoglycin ELISA kit
E08O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Osteoglycin ELISA kit
E08O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Osteoglycin ELISA kit
E09O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Osteoglycin ELISA kit
E09O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Osteoglycin ELISA kit
E09O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human OGN/ Mimecan ELISA Kit
E1824Hu 1 Kit
EUR 605
Human OGN(Mimecan) ELISA Kit
EH2412 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P20774
  • Alias: OGN/Osteoglycin/Osteoinductive factor/KSPG25/OIF/SLRR3A/DKFZp586P2421/mimecan/mimecan proteoglycan/OIFOG/Osteoglycin/osteoglycin/osteoglycin(osteoinductive factor)/Osteoinductive factor/SLRR3A
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Mimecan, OGN ELISA KIT
ELI-45627h 96 Tests
EUR 824
Human Mimecan (OGN) ELISA kit
CSB-EL016314HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mimecan (OGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Mimecan (OGN) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mimecan (OGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
OGN ELISA Kit (Human) (OKAN06221)
OKAN06221 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.5 pg/mL
OGN ELISA Kit (Human) (OKCD08228)
OKCD08228 96 Wells
EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.5pg/mL
OGN ELISA Kit (Human) (OKEH01881)
OKEH01881 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.046 ng/mL
Guinea pig Osteoglycin ELISA kit
E05O0853-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Osteoglycin ELISA kit
E05O0853-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Osteoglycin ELISA kit
E05O0853-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Ogn/ Mimecan ELISA Kit
E1077Mo 1 Kit
EUR 632
Mouse Mimecan, Ogn ELISA KIT
ELI-14029m 96 Tests
EUR 865
Bovine Mimecan, OGN ELISA KIT
ELI-15762b 96 Tests
EUR 928
Rabbit Mimecan, OGN ELISA KIT
ELI-37245Ra 96 Tests
EUR 928
Chicken Mimecan, OGN ELISA KIT
ELI-45626c 96 Tests
EUR 928
OGN ELISA Kit (Mouse) (OKCD02775)
OKCD02775 96 Wells
EUR 857
Description: Description of target: Induces bone formation in conjunction with TGF-beta-1 or TGF-beta-2. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL
Ogn ELISA Kit (Mouse) (OKBB01131)
OKBB01131 96 Wells
EUR 505
Description: Description of target: Osteoglycin (also called mimecan) is a protein that in humans is encoded by the OGN gene. This gene encodes a protein which induces ectopic bone formation in conjunction with transforming growth factor beta. This protein is a small proteoglycan which contains tandem leucine-rich repeats (LRR). The level of expression of this gene has been correlated with enlarged hearts and more specifically left ventricular hypertrophy. Mimecan belongs to a family of small leucine-rich proteoglycans (SLRPs). The mimecan gene was expressed at a moderate level in the mouse pituitary gland by Northern blot analysis. Expression of mimecan mRNA and protein is also observed in the human anterior pituitary gland. The OGN gene was mapped to chromosome 9q22.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <12pg/ml
OGN ELISA Kit (Chicken) (OKEH08716)
OKEH08716 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Human Mimecan (OGN)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 33.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mimecan(OGN) expressed in Yeast
Human Mimecan (OGN)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mimecan(OGN) expressed in E.coli
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Ogn ELISA Kit| Mouse Mimecan ELISA Kit
EF015766 96 Tests
EUR 689
OGN ELISA Kit| Bovine Mimecan ELISA Kit
EF011699 96 Tests
EUR 689
OGN ELISA Kit| chicken Mimecan ELISA Kit
EF012446 96 Tests
EUR 689
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
OGN antibody
70R-19033 50 ul
EUR 435
Description: Rabbit polyclonal OGN antibody
OGN Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
OGN Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
OGN Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
OGN Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:300, IF:1:50-1:200
Human OGN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
OGN Recombinant Protein (Human)
RP022081 100 ug Ask for price
Osteoglycin Polyclonal Antibody
ES4024-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Osteoglycin from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Osteoglycin Polyclonal Antibody
ES4024-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Osteoglycin from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
anti- Osteoglycin antibody
FNab06032 100µg
EUR 505.25
  • Immunogen: osteoglycin
  • Uniprot ID: P20774
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against Osteoglycin
Osteoglycin Polyclonal Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Osteoglycin Polyclonal Antibody
ABP53025-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin
  • Applications tips:
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin
Osteoglycin Polyclonal Antibody
ABP53025-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin
  • Applications tips:
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin
Osteoglycin Polyclonal Antibody
ABP53025-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin
  • Applications tips:
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin
Anti-Osteoglycin Antibody
A07061 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.
Osteoglycin Polyclonal Antibody
41700-100ul 100ul
EUR 252
Osteoglycin Polyclonal Antibody
41700-50ul 50ul
EUR 187
Anti-Osteoglycin antibody
PAab06032 100 ug
EUR 355
Anti-Osteoglycin antibody
STJ96659 200 µl
EUR 197
Description: Rabbit polyclonal to Osteoglycin.
OGN cloning plasmid
CSB-CL016314HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgaagactctgcagtctacacttctcctgttactgcttgtgcctctgataaagccagcaccaccaacccagcaggactcacgcattatctatgattatggaacagataattttgaagaatccatatttagccaagattatgaggataaatacctggatggaaaaaatattaagga
  • Show more
Description: A cloning plasmid for the OGN gene.
Mimecan (OGN) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody
abx026375-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody
abx026375-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
OGN Polyclonal Antibody
A57045 100 µg
EUR 570.55
Description: Ask the seller for details
OGN Rabbit pAb
A6679-100ul 100 ul
EUR 308
OGN Rabbit pAb
A6679-200ul 200 ul
EUR 459
OGN Rabbit pAb
A6679-20ul 20 ul
EUR 183
OGN Rabbit pAb
A6679-50ul 50 ul
EUR 223
OGN Polyclonal Antibody
30722-100ul 100ul
EUR 252
OGN Polyclonal Antibody
30722-50ul 50ul
EUR 187
Anti-OGN antibody
STJ28762 100 µl
EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
OGN ORF Vector (Human) (pORF)
ORF007361 1.0 ug DNA
EUR 95
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Osteoglycin Polyclonal Conjugated Antibody
C41700 100ul
EUR 397
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
OGN Polyclonal Conjugated Antibody
C30722 100ul
EUR 397
Mimecan (OGN) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mimecan (OGN) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-OIF/Ogn Antibody
A07061-1 100ug/vial
EUR 294
Mouse OGN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
OGN Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
OGN Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
OGN Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
OGN Recombinant Protein (Rat)
RP215105 100 ug Ask for price
OGN Recombinant Protein (Mouse)
RP155843 100 ug Ask for price
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
OGN sgRNA CRISPR Lentivector set (Human)
K1480501 3 x 1.0 ug
EUR 339
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
OGN sgRNA CRISPR Lentivector (Human) (Target 1)
K1480502 1.0 ug DNA
EUR 154
OGN sgRNA CRISPR Lentivector (Human) (Target 2)
K1480503 1.0 ug DNA
EUR 154
OGN sgRNA CRISPR Lentivector (Human) (Target 3)
K1480504 1.0 ug DNA
EUR 154