NEDD8

Rabbit NEDD8, NEDD8 ELISA KIT

ELI-20691Ra 96 Tests
EUR 928

Human NEDD8, NEDD8 ELISA KIT

ELI-16853h 96 Tests
EUR 824

Bovine NEDD8, NEDD8 ELISA KIT

ELI-45662b 96 Tests
EUR 928

Mouse NEDD8, Nedd8 ELISA KIT

ELI-39574m 96 Tests
EUR 865

Nedd8/ Rat Nedd8 ELISA Kit

ELI-39575r 96 Tests
EUR 886

NEDD8 siRNA

20-abx903522
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEDD8 Antibody

BF0274 200ul
EUR 376
Description: NEDD8 antibody detects endogenous levels of total NEDD8.

NEDD8 Antibody

AF0271 200ul
EUR 304
Description: NEDD8 antibody detects endogenous levels of total NEDD8.

NEDD8 Antibody

ABF0271 100 ug
EUR 438

NEDD8 siRNA

20-abx925690
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEDD8 siRNA

20-abx925691
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEDD8 antibody

70R-50112 100 ul
EUR 244
Description: Purified Polyclonal NEDD8 antibody

NEDD8 antibody

70R-30793 100 ug
EUR 327
Description: Rabbit polyclonal NEDD8 antibody

NEDD8 Antibody

ABD13178 100 ug
EUR 438

NEDD8 Antibody

ABD6297 100 ug
EUR 438

NEDD8 Antibody

33513-100ul 100ul
EUR 252

NEDD8 Antibody

33513-50ul 50ul
EUR 187

NEDD8 Antibody

49398-100ul 100ul
EUR 333

NEDD8 Antibody

49398-50ul 50ul
EUR 239

NEDD8-AMC

4843-25
EUR 305

NEDD8 protein

30R-2728 25 ug
EUR 403
Description: Synthetic NEDD8 protein

NEDD8 Antibody

32194-100ul 100ul
EUR 252

NEDD8 antibody

70R-18833 50 ul
EUR 435
Description: Rabbit polyclonal NEDD8 antibody

NEDD8 Antibody

DF6297 200ul
EUR 304
Description: NEDD8 Antibody detects endogenous levels of total NEDD8.

NEDD8 Antibody

1-CSB-PA003391
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

NEDD8 Antibody

1-CSB-PA618018ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

NEDD8 Antibody

1-CSB-PA618018ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

NEDD8 Antibody

CSB-PA053660-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NEDD8 Antibody

CSB-PA053660-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NEDD8 Antibody

1-CSB-PA015684GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-NEDD8

YF-PA24225 50 ul
EUR 334
Description: Mouse polyclonal to NEDD8

NEDD8 Conjugated Antibody

C49398 100ul
EUR 397

NEDD8 Blocking Peptide

BF0274-BP 1mg
EUR 195

NEDD8 Conjugated Antibody

C32194 100ul
EUR 397

NEDD8 Blocking Peptide

AF0271-BP 1mg
EUR 195

NEDD8 cloning plasmid

CSB-CL618018HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 246
  • Sequence: ATGCTAATTAAAGTGAAGACGCTGACCGGAAAGGAGATTGAGATTGACATTGAACCTACAGACAAGGTGGAGCGAATCAAGGAGCGTGTGGAGGAGAAAGAGGGAATCCCCCCACAACAGCAGAGGCTCATCTACAGTGGCAAGCAGATGAATGATGAGAAGACAGCAGCTGATTA
  • Show more
Description: A cloning plasmid for the NEDD8 gene.

anti- NEDD8 antibody

FNab05647 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: neural precursor cell expressed, developmentally down-regulated 8
  • Uniprot ID: Q15843
  • Gene ID: 4738
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against NEDD8

NEDD8 Blocking Peptide

20-abx062987
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-NEDD8 Antibody

A00547 100ug/vial
EUR 334

NEDD8 Rabbit pAb

A0591-100ul 100 ul
EUR 384

NEDD8 Rabbit pAb

A0591-200ul 200 ul Ask for price

NEDD8 Rabbit pAb

A0591-20ul 20 ul Ask for price

NEDD8 Rabbit pAb

A0591-50ul 50 ul
EUR 265

NEDD8 Rabbit pAb

A1163-100ul 100 ul
EUR 308

NEDD8 Rabbit pAb

A1163-200ul 200 ul
EUR 459

NEDD8 Rabbit pAb

A1163-20ul 20 ul
EUR 183

NEDD8 Rabbit pAb

A1163-50ul 50 ul
EUR 223

NEDD8 Rabbit pAb

A13520-100ul 100 ul
EUR 308

NEDD8 Rabbit pAb

A13520-200ul 200 ul
EUR 459

NEDD8 Rabbit pAb

A13520-20ul 20 ul
EUR 183

NEDD8 Rabbit pAb

A13520-50ul 50 ul
EUR 223

Human NEDD8 Antibody

32539-05111 150 ug
EUR 261

NEDD8 Blocking Peptide

DF6297-BP 1mg
EUR 195

Anti-NEDD8 antibody

PAab05647 100 ug
EUR 355

anti-NEDD8 (1A7)

LF-MA30675 100 ul
EUR 527
Description: Mouse Monoclonal to NEDD8

anti-NEDD8 (5B8)

LF-MA30676 100 ul
EUR 527
Description: Mouse Monoclonal to NEDD8

Anti-NEDD8 antibody

STJ29839 100 µl
EUR 277

Anti-NEDD8 antibody

STJ24730 100 µl
EUR 393

Anti-NEDD8 antibody

STJ115481 100 µl
EUR 277

NEDD8 Cell ELISA Kit

abx595417-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Rat NEDD8 shRNA Plasmid

20-abx985064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEDD8 ELISA KIT|Human

EF001168 96 Tests
EUR 689

NEDD8 conjugating enzyme Antibody

abx432110-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human NEDD8 shRNA Plasmid

20-abx953147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEDD8 protein (His tag)

80R-1104 100 ug
EUR 305
Description: Purified recombinant Human NEDD8 protein

NEDD8 recombinant monoclonal antibody

A5205 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NEDD8 for WB, IF,ELISA

Mouse NEDD8 shRNA Plasmid

20-abx971707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human NEDD8 Protein

RP00059 5 μg
EUR 174

Nedd8 Recombinant Protein (Human)

RP041608 100 ug Ask for price

Nedd8 Recombinant Protein (Rat)

RP213632 100 ug Ask for price

pDNR-LIB-NEDD8 Plasmid

PVT15936 2 ug
EUR 325

Nedd8 Recombinant Protein (Mouse)

RP153605 100 ug Ask for price

Polyclonal NEDD8 Antibody (aa10-59)

APR02835G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEDD8 (aa10-59). This antibody is tested and proven to work in the following applications:

Monoclonal NEDD8 Antibody, Clone: 1A7

APR08709G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NEDD8. The antibodies are raised in Mouse and are from clone 1A7. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal NEDD8 Antibody, Clone: 5B8

APR08710G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NEDD8. The antibodies are raised in Mouse and are from clone 5B8. This antibody is applicable in WB and IHC, FC, ICC, E

Human NEDD8 Antibody (Biotin Conjugate)

32539-05121 150 ug
EUR 369

Anti-NEDD8 Rabbit Monoclonal Antibody

M00547 100ug/vial
EUR 397
Description: Rabbit Monoclonal NEDD8 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Nedd8 ORF Vector (Rat) (pORF)

ORF071212 1.0 ug DNA
EUR 506

NEDD8 ORF Vector (Human) (pORF)

ORF013870 1.0 ug DNA
EUR 95

Nedd8 ORF Vector (Mouse) (pORF)

ORF051203 1.0 ug DNA
EUR 506

NEDD8-MDP1 Recombinant Protein (Human)

RP078063 100 ug Ask for price

mlN4924 (NEDD8 activating enzyme inhibitor)

SIH-331-1MG 1 mg
EUR 1004
  • Potent and selective NEDD8-activating enzyme (NAE) inhibitor. It disrupts cullin-RING ligase-mediated protein turnover leading to apoptosis in human tumor cells. It suppresses the growth of human tumor xenografts in mice. Cell permeable.
Description: The substance mlN4924 is a nedd8 activating enzyme inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white powder which is soluble in 10 mg/ml DMSO.

mlN4924 (NEDD8 activating enzyme inhibitor)

SIH-331-200UG 200 µg
EUR 312
  • Potent and selective NEDD8-activating enzyme (NAE) inhibitor. It disrupts cullin-RING ligase-mediated protein turnover leading to apoptosis in human tumor cells. It suppresses the growth of human tumor xenografts in mice. Cell permeable.
Description: The substance mlN4924 is a nedd8 activating enzyme inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white powder which is soluble in 10 mg/ml DMSO.

NEDD8 Colorimetric Cell-Based ELISA Kit

EKC1396 100ul
EUR 572

NEDD8-Conjugating Enzyme Ubc12 (UBE2M) Antibody

20-abx123524
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NEDD8 Ultimate Buster 1 (NUB1) Antibody

20-abx124654
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

NEDD8-Conjugating Enzyme Ubc12 (UBE2M) Antibody

abx122733-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NEDD8-Conjugating Enzyme UBE2F (UBE2F) Antibody

abx122734-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NEDD8 Ultimate Buster 1 (NUB1) Antibody

20-abx008140
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

NEDD8-Conjugating Enzyme UBE2F (UBE2F) Antibody

20-abx003953
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NEDD8-Conjugating Enzyme UBE2F (UBE2F) Antibody

20-abx321307
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NEDD8 ultimate buster 1 (NUB1) Antibody

20-abx326307
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEDD8-Conjugating Enzyme Ubc12 (UBE2M) Antibody

20-abx219212
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEDD8 ultimate buster 1 (NUB1) Antibody

abx331552-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

NEDD8-Conjugating Enzyme 2 (NCE2) Antibody

abx430159-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.