RPS25

RPS25 Antibody
47710-100ul 100ul
EUR 252
RPS25 antibody
70R-15160 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody
RPS25 antibody
70R-15370 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody
RPS25 Antibody
34337-100ul 100ul
EUR 252
RPS25 Antibody
34337-50ul 50ul
EUR 187
RPS25 Antibody
1-CSB-PA040278
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
RPS25 Antibody
CSB-PA202684-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
RPS25 Antibody
CSB-PA202684-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
RPS25 Antibody
1-CSB-PA00644A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
RPS25 Antibody
1-CSB-PA00645A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
RPS25 antibody
70R-33925 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody
RPS25 siRNA
20-abx904700
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS25 siRNA
20-abx932065
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS25 siRNA
20-abx932066
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS25 Rabbit pAb
A15314-100ul 100 ul
EUR 308
RPS25 Rabbit pAb
A15314-200ul 200 ul
EUR 459
RPS25 Rabbit pAb
A15314-20ul 20 ul
EUR 183
RPS25 Rabbit pAb
A15314-50ul 50 ul
EUR 223
RPS25 antibody (HRP)
60R-1317 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody (HRP)
RPS25 antibody (FITC)
60R-1318 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody (FITC)
RPS25 antibody (biotin)
60R-1319 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody (biotin)
RPS25 antibody (HRP)
60R-1924 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody (HRP)
RPS25 antibody (FITC)
60R-1925 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody (FITC)
RPS25 antibody (biotin)
60R-1926 100 ug
EUR 327
Description: Rabbit polyclonal RPS25 antibody (biotin)
RPS25 Conjugated Antibody
C47710 100ul
EUR 397
RPS25 Conjugated Antibody
C34337 100ul
EUR 397
RPS25 cloning plasmid
CSB-CL020406HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atgccgcctaaggacgacaagaagaagaaggacgctggaaagtcggccaagaaagacaaagacccagtgaacaaatccgggggcaaggccaaaaagaagaagtggtccaaaggcaaagttcgggacaagctcaataacttagtcttgtttgacaaagctacctatgataaactctg
  • Show more
Description: A cloning plasmid for the RPS25 gene.
RPS25 Rabbit pAb
A9573-100ul 100 ul
EUR 308
RPS25 Rabbit pAb
A9573-200ul 200 ul
EUR 459
RPS25 Rabbit pAb
A9573-20ul 20 ul Ask for price
RPS25 Rabbit pAb
A9573-50ul 50 ul Ask for price
RPS25 Polyclonal Antibody
A51481 100 µg
EUR 570.55
Description: reagents widely cited
RPS25 Polyclonal Antibody
A51873 100 µg
EUR 570.55
Description: The best epigenetics products
anti- RPS25 antibody
FNab07467 100µg
EUR 585
  • Immunogen: ribosomal protein S25
  • Uniprot ID: P62851
  • Gene ID: 6230
  • Research Area: Metabolism
Description: Antibody raised against RPS25
anti- RPS25 antibody
FNab07468 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: ribosomal protein S25
  • Uniprot ID: P62851
  • Gene ID: 6230
  • Research Area: Metabolism
Description: Antibody raised against RPS25
Anti-RPS25 antibody
PAab07467 100 ug
EUR 412
Anti-RPS25 antibody
PAab07468 100 ug
EUR 412
Anti-RPS25 antibody
STJ111749 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S25E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
Anti-RPS25 antibody
STJ117509 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S25E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
RPS25 Antibody, HRP conjugated
1-CSB-PA00644B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS25 Antibody, FITC conjugated
1-CSB-PA00644C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS25 Antibody, Biotin conjugated
1-CSB-PA00644D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RPS25 Antibody, HRP conjugated
1-CSB-PA00645B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS25 Antibody, FITC conjugated
1-CSB-PA00645C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS25 Antibody, Biotin conjugated
1-CSB-PA00645D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS25. Recognizes RPS25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RPS25 ELISA KIT|Human
EF002624 96 Tests
EUR 689
Mouse RPS25 shRNA Plasmid
20-abx978447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS25 shRNA Plasmid
20-abx987485
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPS25 shRNA Plasmid
20-abx954193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS25 Recombinant Protein (Human)
RP027160 100 ug Ask for price
RPS25 Recombinant Protein (Mouse)
RP169235 100 ug Ask for price
RPS25 Recombinant Protein (Rat)
RP226832 100 ug Ask for price
Ribosomal Protein S25 (RPS25) Antibody
20-abx123482
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S25 (RPS25) Antibody
20-abx014101
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ribosomal Protein S25 (RPS25) Antibody
abx034482-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S25 (RPS25) Antibody
abx034482-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S25 (RPS25) Antibody
abx237467-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Ribosomal Protein S25 (RPS25) Antibody
abx237468-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Ribosomal Protein S25 (RPS25) Antibody
abx331389-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Ribosomal Protein S25 (RPS25) Antibody
20-abx326439
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS25 Polyclonal Antibody, HRP Conjugated
A51482 100 µg
EUR 570.55
Description: Ask the seller for details
RPS25 Polyclonal Antibody, FITC Conjugated
A51483 100 µg
EUR 570.55
Description: The best epigenetics products
RPS25 Polyclonal Antibody, Biotin Conjugated
A51484 100 µg
EUR 570.55
Description: kits suitable for this type of research
RPS25 Polyclonal Antibody, HRP Conjugated
A51874 100 µg
EUR 570.55
Description: kits suitable for this type of research
RPS25 Polyclonal Antibody, FITC Conjugated
A51875 100 µg
EUR 570.55
Description: fast delivery possible
RPS25 Polyclonal Antibody, Biotin Conjugated
A51876 100 µg
EUR 570.55
Description: reagents widely cited
Rps25 ORF Vector (Rat) (pORF)
ORF075612 1.0 ug DNA
EUR 506
RPS25 ORF Vector (Human) (pORF)
ORF009054 1.0 ug DNA
EUR 95
Rps25 ORF Vector (Mouse) (pORF)
ORF056413 1.0 ug DNA
EUR 506
Anti-RPS25/Ribosomal Protein S25 Antibody
A09150-1 100ul
EUR 397
Description: Rabbit Polyclonal RPS25/Ribosomal Protein S25 Antibody. Validated in IHC and tested in Human, Mouse, Rat.
Human 40S ribosomal protein S25 (RPS25)
1-CSB-RP006444h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S25(RPS25) expressed in E.coli
Ribosomal Protein S25 (RPS25) Antibody Pair
abx117372-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.
40S Ribosomal Protein S25 (RPS25) Antibody
20-abx109459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
40S Ribosomal Protein S25 (RPS25) Antibody
20-abx109460
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps25 sgRNA CRISPR Lentivector set (Rat)
K7118101 3 x 1.0 ug
EUR 339
Rps25 sgRNA CRISPR Lentivector set (Mouse)
K4483901 3 x 1.0 ug
EUR 339
RPS25 sgRNA CRISPR Lentivector set (Human)
K2047101 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S25 (RPS25) ELISA Kit
20-abx585301
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Rps25 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7118102 1.0 ug DNA
EUR 154
Rps25 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7118103 1.0 ug DNA
EUR 154
Rps25 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7118104 1.0 ug DNA
EUR 154
Rps25 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4483902 1.0 ug DNA
EUR 154
Rps25 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4483903 1.0 ug DNA
EUR 154
Rps25 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4483904 1.0 ug DNA
EUR 154
RPS25 sgRNA CRISPR Lentivector (Human) (Target 1)
K2047102 1.0 ug DNA
EUR 154