COPZ1 siRNA
20-abx912537	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

COPZ1 antibody
70R-35542	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal COPZ1 antibody

COPZ1 Antibody
ABD3952	Lifescience Market	100 ug	EUR 438

COPZ1 Antibody
34603-100ul	SAB	100ul	EUR 252

COPZ1 Antibody
34603-50ul	SAB	50ul	EUR 187

COPZ1 antibody
70R-16519	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal COPZ1 antibody

COPZ1 Antibody
DF3952	Affbiotech	200ul	EUR 304
Description: COPZ1 Antibody detects endogenous levels of total COPZ1.

COPZ1 Antibody
1-CSB-PA001759	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

COPZ1 Antibody
1-CSB-PA005797GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

COPZ1 Antibody
1-CSB-PA005797LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

COPZ1 Antibody
CSB-PA217102-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

COPZ1 Antibody
CSB-PA217102-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

COPZ1 Conjugated Antibody
C34603	SAB	100ul	EUR 397

COPZ1 cloning plasmid
CSB-CL005797HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 534 Sequence: atggaggcgctgattttggaaccttccctgtatactgtcaaagccatcctgattctggacaatgatggagatcgactttttgccaagtactatgacgacacctaccccagtgtcaaggagcaaaaggcctttgagaagaacattttcaacaagacccatcggactgacagtgaaat Show more
Description: A cloning plasmid for the COPZ1 gene.

anti- COPZ1 antibody
FNab01875	FN Test	100µg	EUR 505.25
Immunogen: coatomer protein complex, subunit zeta 1 Uniprot ID: P61923 Gene ID: 22818 Research Area: Signal Transduction
Description: Antibody raised against COPZ1

COPZ1 Rabbit pAb
A12148-100ul	Abclonal	100 ul	EUR 308

COPZ1 Rabbit pAb
A12148-200ul	Abclonal	200 ul	EUR 459

COPZ1 Rabbit pAb
A12148-20ul	Abclonal	20 ul	EUR 183

COPZ1 Rabbit pAb
A12148-50ul	Abclonal	50 ul	EUR 223

Anti-COPZ1 Antibody
A07977	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal COPZ1 Antibody. Validated in IHC, WB and tested in Human, Mouse.

COPZ1 Polyclonal Antibody
A62314	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

COPZ1 Blocking Peptide
DF3952-BP	Affbiotech	1mg	EUR 195

Anti-COPZ1 antibody
PAab01875	Lifescience Market	100 ug	EUR 355

Anti-COPZ1 antibody
STJ114041	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a subunit of the cytoplasmic coatamer protein complex, which is involved in autophagy and intracellular protein trafficking. The coatomer protein complex is comprised of seven subunits and functions as the coat protein of coat protein complex (COP)I-vesicles. Alternative splicing results in multiple transcript variants.

Mouse COPZ1 shRNA Plasmid
20-abx974780	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

COPZ1 ELISA KIT|Human
EF008801	Lifescience Market	96 Tests	EUR 689

Human COPZ1 shRNA Plasmid
20-abx957787	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

COPZ1 protein (His tag)
80R-1805	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human COPZ1 protein

COPZ1 Antibody, HRP conjugated
1-CSB-PA005797LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COPZ1 Antibody, FITC conjugated
1-CSB-PA005797LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COPZ1 Antibody, Biotin conjugated
1-CSB-PA005797LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COPZ1 Recombinant Protein (Human)
RP007711	ABM	100 ug	Ask for price

COPZ1 Recombinant Protein (Rat)
RP195929	ABM	100 ug	Ask for price

COPZ1 Recombinant Protein (Mouse)
RP125519	ABM	100 ug	Ask for price

COPZ1 Polyclonal Antibody, HRP Conjugated
A62315	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

COPZ1 Polyclonal Antibody, FITC Conjugated
A62316	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

COPZ1 Polyclonal Antibody, Biotin Conjugated
A62317	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

COPZ1 ORF Vector (Human) (pORF)
ORF002571	ABM	1.0 ug DNA	EUR 95

Copz1 ORF Vector (Rat) (pORF)
ORF065311	ABM	1.0 ug DNA	EUR 506

Copz1 ORF Vector (Mouse) (pORF)
ORF041841	ABM	1.0 ug DNA	EUR 506

Polyclonal COPZ1 Antibody - C-terminal region
APR15556G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COPZ1 - C-terminal region. This antibody is tested and proven to work in the following applications:

COPZ1 sgRNA CRISPR Lentivector set (Human)
K0490001	ABM	3 x 1.0 ug	EUR 339

Copz1 sgRNA CRISPR Lentivector set (Rat)
K6142701	ABM	3 x 1.0 ug	EUR 339

Copz1 sgRNA CRISPR Lentivector set (Mouse)
K4845401	ABM	3 x 1.0 ug	EUR 339

COPZ1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0490002	ABM	1.0 ug DNA	EUR 154

COPZ1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0490003	ABM	1.0 ug DNA	EUR 154

COPZ1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0490004	ABM	1.0 ug DNA	EUR 154

Copz1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6142702	ABM	1.0 ug DNA	EUR 154

Copz1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6142703	ABM	1.0 ug DNA	EUR 154

Copz1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6142704	ABM	1.0 ug DNA	EUR 154

Copz1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4845402	ABM	1.0 ug DNA	EUR 154

Copz1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4845403	ABM	1.0 ug DNA	EUR 154

Copz1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4845404	ABM	1.0 ug DNA	EUR 154

Recombinant Human COPZ1 Protein, His, E.coli-10ug
QP11487-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human COPZ1 Protein, His, E.coli-1mg
QP11487-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human COPZ1 Protein, His, E.coli-2ug
QP11487-2ug	EnQuireBio	2ug	EUR 155

COPZ1 Protein Vector (Human) (pPB-C-His)
PV010281	ABM	500 ng	EUR 329

COPZ1 Protein Vector (Human) (pPB-N-His)
PV010282	ABM	500 ng	EUR 329

COPZ1 Protein Vector (Human) (pPM-C-HA)
PV010283	ABM	500 ng	EUR 329

COPZ1 Protein Vector (Human) (pPM-C-His)
PV010284	ABM	500 ng	EUR 329

COPZ1 Protein Vector (Mouse) (pPB-C-His)
PV167362	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Mouse) (pPB-N-His)
PV167363	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Mouse) (pPM-C-HA)
PV167364	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Mouse) (pPM-C-His)
PV167365	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Rat) (pPB-C-His)
PV261242	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Rat) (pPB-N-His)
PV261243	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Rat) (pPM-C-HA)
PV261244	ABM	500 ng	EUR 603

COPZ1 Protein Vector (Rat) (pPM-C-His)
PV261245	ABM	500 ng	EUR 603

Copz1 3'UTR Luciferase Stable Cell Line
TU202668	ABM	1.0 ml	Ask for price

Copz1 3'UTR GFP Stable Cell Line
TU154234	ABM	1.0 ml	Ask for price