COPZ1

COPZ1 Antibody

34603-100ul 100ul
EUR 252

COPZ1 Antibody

34603-50ul 50ul
EUR 187

COPZ1 Antibody

1-CSB-PA005797GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

COPZ1 Antibody

1-CSB-PA005797LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

COPZ1 Antibody

1-CSB-PA001759
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

COPZ1 Antibody

DF3952 200ul
EUR 304
Description: COPZ1 Antibody detects endogenous levels of total COPZ1.

COPZ1 Antibody

CSB-PA217102-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

COPZ1 Antibody

CSB-PA217102-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

COPZ1 antibody

70R-35542 100 ug
EUR 327
Description: Purified Rabbit polyclonal COPZ1 antibody

COPZ1 siRNA

20-abx912536
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COPZ1 siRNA

20-abx912537
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COPZ1 Antibody

ABD3952 100 ug
EUR 438

Anti-COPZ1 Antibody

A07977 100ul
EUR 397
Description: Rabbit Polyclonal COPZ1 Antibody. Validated in IHC, WB and tested in Human, Mouse.

COPZ1 Rabbit pAb

A12148-100ul 100 ul
EUR 308

COPZ1 Rabbit pAb

A12148-200ul 200 ul
EUR 459

COPZ1 Rabbit pAb

A12148-20ul 20 ul
EUR 183

COPZ1 Rabbit pAb

A12148-50ul 50 ul
EUR 223

COPZ1 Blocking Peptide

DF3952-BP 1mg
EUR 195

COPZ1 Conjugated Antibody

C34603 100ul
EUR 397

COPZ1 cloning plasmid

CSB-CL005797HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 534
  • Sequence: atggaggcgctgattttggaaccttccctgtatactgtcaaagccatcctgattctggacaatgatggagatcgactttttgccaagtactatgacgacacctaccccagtgtcaaggagcaaaaggcctttgagaagaacattttcaacaagacccatcggactgacagtgaaat
  • Show more
Description: A cloning plasmid for the COPZ1 gene.

COPZ1 Polyclonal Antibody

A62314 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- COPZ1 antibody

FNab01875 100µg
EUR 505.25
  • Immunogen: coatomer protein complex, subunit zeta 1
  • Uniprot ID: P61923
  • Gene ID: 22818
  • Research Area: Signal Transduction
Description: Antibody raised against COPZ1

Anti-COPZ1 antibody

PAab01875 100 ug
EUR 355

Anti-COPZ1 antibody

STJ114041 100 µl
EUR 277
Description: This gene encodes a subunit of the cytoplasmic coatamer protein complex, which is involved in autophagy and intracellular protein trafficking. The coatomer protein complex is comprised of seven subunits and functions as the coat protein of coat protein complex (COP)I-vesicles. Alternative splicing results in multiple transcript variants.

COPZ1 Antibody, HRP conjugated

1-CSB-PA005797LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COPZ1 Antibody, FITC conjugated

1-CSB-PA005797LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COPZ1 Antibody, Biotin conjugated

1-CSB-PA005797LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPZ1. Recognizes COPZ1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COPZ1 protein (His tag)

80R-1805 50 ug
EUR 397
Description: Purified recombinant Human COPZ1 protein

COPZ1 ELISA KIT|Human

EF008801 96 Tests
EUR 689

Mouse COPZ1 shRNA Plasmid

20-abx974780
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human COPZ1 shRNA Plasmid

20-abx957787
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

COPZ1 Recombinant Protein (Human)

RP007711 100 ug Ask for price

COPZ1 Recombinant Protein (Rat)

RP195929 100 ug Ask for price

COPZ1 Recombinant Protein (Mouse)

RP125519 100 ug Ask for price

COPZ1 Polyclonal Antibody, HRP Conjugated

A62315 100 µg
EUR 570.55
Description: fast delivery possible

COPZ1 Polyclonal Antibody, FITC Conjugated

A62316 100 µg
EUR 570.55
Description: reagents widely cited

COPZ1 Polyclonal Antibody, Biotin Conjugated

A62317 100 µg
EUR 570.55
Description: Ask the seller for details

Copz1 ORF Vector (Rat) (pORF)

ORF065311 1.0 ug DNA
EUR 506

COPZ1 ORF Vector (Human) (pORF)

ORF002571 1.0 ug DNA
EUR 95

Copz1 ORF Vector (Mouse) (pORF)

ORF041841 1.0 ug DNA
EUR 506

Polyclonal COPZ1 Antibody - C-terminal region

APR15556G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COPZ1 - C-terminal region. This antibody is tested and proven to work in the following applications:

COPZ1 sgRNA CRISPR Lentivector set (Human)

K0490001 3 x 1.0 ug
EUR 339

Copz1 sgRNA CRISPR Lentivector set (Rat)

K6142701 3 x 1.0 ug
EUR 339

Copz1 sgRNA CRISPR Lentivector set (Mouse)

K4845401 3 x 1.0 ug
EUR 339

COPZ1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0490002 1.0 ug DNA
EUR 154

COPZ1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0490003 1.0 ug DNA
EUR 154

COPZ1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0490004 1.0 ug DNA
EUR 154

Copz1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6142702 1.0 ug DNA
EUR 154

Copz1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6142703 1.0 ug DNA
EUR 154

Copz1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6142704 1.0 ug DNA
EUR 154

Copz1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4845402 1.0 ug DNA
EUR 154

Copz1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4845403 1.0 ug DNA
EUR 154

Copz1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4845404 1.0 ug DNA
EUR 154

COPZ1 Protein Vector (Mouse) (pPB-C-His)

PV167362 500 ng
EUR 603

COPZ1 Protein Vector (Mouse) (pPB-N-His)

PV167363 500 ng
EUR 603

COPZ1 Protein Vector (Mouse) (pPM-C-HA)

PV167364 500 ng
EUR 603

COPZ1 Protein Vector (Mouse) (pPM-C-His)

PV167365 500 ng
EUR 603

COPZ1 Protein Vector (Rat) (pPB-C-His)

PV261242 500 ng
EUR 603

COPZ1 Protein Vector (Rat) (pPB-N-His)

PV261243 500 ng
EUR 603

COPZ1 Protein Vector (Rat) (pPM-C-HA)

PV261244 500 ng
EUR 603

COPZ1 Protein Vector (Rat) (pPM-C-His)

PV261245 500 ng
EUR 603

COPZ1 Protein Vector (Human) (pPB-C-His)

PV010281 500 ng
EUR 329

COPZ1 Protein Vector (Human) (pPB-N-His)

PV010282 500 ng
EUR 329

COPZ1 Protein Vector (Human) (pPM-C-HA)

PV010283 500 ng
EUR 329

COPZ1 Protein Vector (Human) (pPM-C-His)

PV010284 500 ng
EUR 329

Recombinant Human COPZ1 Protein, His, E.coli-10ug

QP11487-10ug 10ug
EUR 201

Recombinant Human COPZ1 Protein, His, E.coli-1mg

QP11487-1mg 1mg
EUR 5251

Recombinant Human COPZ1 Protein, His, E.coli-2ug

QP11487-2ug 2ug
EUR 155

Copz1 3'UTR GFP Stable Cell Line

TU154234 1.0 ml Ask for price

Copz1 3'UTR Luciferase Stable Cell Line

TU104234 1.0 ml Ask for price