FUCA1

Human Fucosidase Alpha L1, Tissue (FUCa1) ELISA Kit

DLR-FUCa1-Hu-96T 96T
EUR 621
  • Should the Human Fucosidase Alpha L1, Tissue (FUCa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosidase Alpha L1, Tissue (FUCa1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fucosidase Alpha L1, Tissue (FUCa1) ELISA Kit

RD-FUCa1-Hu-48Tests 48 Tests
EUR 478

Human Fucosidase Alpha L1, Tissue (FUCa1) ELISA Kit

RD-FUCa1-Hu-96Tests 96 Tests
EUR 662

Human Fucosidase Alpha L1, Tissue (FUCa1) ELISA Kit

RDR-FUCa1-Hu-48Tests 48 Tests
EUR 500

Human Fucosidase Alpha L1, Tissue (FUCa1) ELISA Kit

RDR-FUCa1-Hu-96Tests 96 Tests
EUR 692

Fuca1/ Rat Fuca1 ELISA Kit

ELI-02724r 96 Tests
EUR 886

FUCA1 siRNA

20-abx902027
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUCA1 siRNA

20-abx917292
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUCA1 siRNA

20-abx917293
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUCA1 antibody

70R-5286 50 ug
EUR 467
Description: Rabbit polyclonal FUCA1 antibody raised against the N terminal of FUCA1

FUCA1 antibody

70R-5428 50 ug
EUR 467
Description: Rabbit polyclonal FUCA1 antibody raised against the middle region of FUCA1

FUCA1 protein

80R-4315 10 ug
EUR 327
Description: Purified Recombinant FUCA1 protein (His tagged)

FUCA1 Antibody

36490-100ul 100ul
EUR 252

FUCA1 antibody

70R-17364 50 ul
EUR 435
Description: Rabbit polyclonal FUCA1 antibody

FUCA1 Antibody

DF13023 200ul
EUR 304
Description: FUCA1 Antibody detects endogenous levels of FUCA1.

FUCA1 Antibody

1-CSB-PA799040
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FUCA1. Recognizes FUCA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Fuca1 Antibody

1-CSB-PA858759LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fuca1. Recognizes Fuca1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

FUCA1 Antibody

1-CSB-PA009062GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FUCA1. Recognizes FUCA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

FUCA1 Antibody

1-CSB-PA009062LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUCA1. Recognizes FUCA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-FUCA1

YF-PA11870 50 ug
EUR 363
Description: Mouse polyclonal to FUCA1

anti-FUCA1

YF-PA11871 100 ug
EUR 403
Description: Rabbit polyclonal to FUCA1

anti-FUCA1

YF-PA23742 50 ul
EUR 334
Description: Mouse polyclonal to FUCA1

anti-FUCA1

YF-PA27230 100 ul
EUR 403
Description: Rabbit polyclonal to FUCA1

FUCA1 Conjugated Antibody

C36490 100ul
EUR 397

FUCA1 cloning plasmid

CSB-CL009062HU-10ug 10ug
EUR 497
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1386
  • Sequence: atgaggtcgcggccggcgggtcccgcgctgttgctgctgctgctcttcctcggagcggccgagtcggtgcgtcgggcccagcctccgcgccgctacaccccagactggccgagcctggattctcggccgctgccggcctggttcgacgaagccaagttcggggtgttcatccact
  • Show more
Description: A cloning plasmid for the FUCA1 gene.

anti- FUCA1 antibody

FNab03237 100µg
EUR 505.25
  • Immunogen: fucosidase, alpha-L-1, tissue
  • Uniprot ID: P04066
  • Gene ID: 2517
  • Research Area: Cancer, Metabolism
Description: Antibody raised against FUCA1

FUCA1 Rabbit pAb

A6291-100ul 100 ul
EUR 308

FUCA1 Rabbit pAb

A6291-200ul 200 ul
EUR 459

FUCA1 Rabbit pAb

A6291-20ul 20 ul
EUR 183

FUCA1 Rabbit pAb

A6291-50ul 50 ul
EUR 223

FUCA1 Rabbit pAb

A14533-100ul 100 ul
EUR 308

FUCA1 Rabbit pAb

A14533-200ul 200 ul
EUR 459

FUCA1 Rabbit pAb

A14533-20ul 20 ul
EUR 183

FUCA1 Rabbit pAb

A14533-50ul 50 ul
EUR 223

FUCA1 Blocking Peptide

33R-7363 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FUCA1 antibody, catalog no. 70R-5286

FUCA1 Blocking Peptide

33R-9215 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FUCA1 antibody, catalog no. 70R-5428

FUCA1 Blocking Peptide

DF13023-BP 1mg
EUR 195

Anti-FUCA1 antibody

PAab03237 100 ug
EUR 355

Anti-FUCA1 antibody

STJ28213 100 µl
EUR 277
Description: The protein encoded by this gene is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in this gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. A pseudogene of this locus is present on chr 2.

Anti-FUCA1 antibody

STJ116744 100 µl
EUR 277
Description: The protein encoded by this gene is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in this gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. A pseudogene of this locus is present on chr 2.

Anti-FUCA1 (1D4)

YF-MA13148 100 ug
EUR 363
Description: Mouse monoclonal to FUCA1

Polyclonal FUCA1 Antibody (Center)

AMM04633G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FUCA1 (Center). This antibody is tested and proven to work in the following applications:

Mouse FUCA1 shRNA Plasmid

20-abx977447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FUCA1 shRNA Plasmid

20-abx984456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FUCa1 ELISA Kit

EHF0145 96Tests
EUR 521

Human FUCA1 ELISA Kit

ELA-E0807h 96 Tests
EUR 824

Goat FUCa1 ELISA Kit

EGTF0145 96Tests
EUR 521

Canine FUCa1 ELISA Kit

ECF0145 96Tests
EUR 521

Chicken FUCa1 ELISA Kit

ECKF0145 96Tests
EUR 521

Bovine FUCa1 ELISA Kit

EBF0145 96Tests
EUR 521

Anserini FUCa1 ELISA Kit

EAF0145 96Tests
EUR 521

Canine FUCA1 ELISA KIT

ELI-02725d 96 Tests
EUR 928

FUCA1 ELISA KIT|Human

EF001210 96 Tests
EUR 689

Porcine FUCa1 ELISA Kit

EPF0145 96Tests
EUR 521

Rat FUCa1 ELISA Kit

ERF0145 96Tests
EUR 521

Rabbit FUCa1 ELISA Kit

ERTF0145 96Tests
EUR 521

Sheep FUCa1 ELISA Kit

ESF0145 96Tests
EUR 521

Mouse FUCa1 ELISA Kit

EMF0145 96Tests
EUR 521

Monkey FUCa1 ELISA Kit

EMKF0145 96Tests
EUR 521

Human FUCA1 shRNA Plasmid

20-abx951664
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Fuca1 Antibody, HRP conjugated

1-CSB-PA858759LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fuca1. Recognizes Fuca1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Fuca1 Antibody, FITC conjugated

1-CSB-PA858759LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fuca1. Recognizes Fuca1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Fuca1 Antibody, Biotin conjugated

1-CSB-PA858759LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fuca1. Recognizes Fuca1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

FUCA1 Antibody, HRP conjugated

1-CSB-PA009062LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUCA1. Recognizes FUCA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FUCA1 Antibody, FITC conjugated

1-CSB-PA009062LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUCA1. Recognizes FUCA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FUCA1 Antibody, Biotin conjugated

1-CSB-PA009062LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUCA1. Recognizes FUCA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FUCA1 Recombinant Protein (Human)

RP012634 100 ug Ask for price

FUCA1 Recombinant Protein (Rat)

RP201860 100 ug Ask for price

FUCA1 Recombinant Protein (Mouse)

RP135383 100 ug Ask for price

Guinea Pig FUCa1 ELISA Kit

EGF0145 96Tests
EUR 521