TSHB

TSHB Antibody
1-CSB-PA11769A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Unconjugated. Tested in the following application: ELISA
TSHB siRNA
20-abx938290
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSHB siRNA
20-abx938291
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSHB Rabbit pAb
A14523-100ul 100 ul
EUR 308
TSHB Rabbit pAb
A14523-200ul 200 ul
EUR 459
TSHB Rabbit pAb
A14523-20ul 20 ul
EUR 183
TSHB Rabbit pAb
A14523-50ul 50 ul
EUR 223
TSHB Conjugated Antibody
C39176 100ul
EUR 397
TSHB cloning plasmid
CSB-CL025130HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgactgctctctttctgatgtccatgctttttggccttgcatgtgggcaagcgatgtctttttgtattccaactgagtatacaatgcacatcgaaaggagagagtgtgcttattgcctaaccatcaacaccaccatctgtgctggatattgtatgacacgggatatcaatggcaa
  • Show more
Description: A cloning plasmid for the TSHB gene.
TSHB Rabbit pAb
A6780-100ul 100 ul
EUR 308
TSHB Rabbit pAb
A6780-200ul 200 ul
EUR 459
TSHB Rabbit pAb
A6780-20ul 20 ul
EUR 183
TSHB Rabbit pAb
A6780-50ul 50 ul
EUR 223
TSHB Polyclonal Antibody
A50684 100 µg
EUR 570.55
Description: Ask the seller for details
TSHB Polyclonal Antibody
ABP60782-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TSHB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein
TSHB Polyclonal Antibody
ABP60782-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TSHB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein
TSHB Polyclonal Antibody
ABP60782-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TSHB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein
TSHB Polyclonal Antibody
ES11163-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TSHB Polyclonal Antibody
ES11163-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Recombinant Rat Tshb
P2468 100ug Ask for price
  • Uniprot ID: P04652
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for Rat Tshb
Anti-TSHB antibody
STJ28863 100 µl
EUR 277
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.
Anti-TSHB antibody
STJ116734 100 µl
EUR 277
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.
Anti-TSHB antibody
STJ400191 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.
Anti-TSHB antibody
STJ400193 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.
Anti-TSHB antibody
STJ400194 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.
Anti-TSHB antibody
STJ400195 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.
Anti-TSHB antibody
STJ400196 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.
Anti-TSHB antibody
STJ400197 1 mg
EUR 424
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.
Anti-TSHB antibody
STJ192321 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TSHB
Anti-TSHB Antibody
STJ503423 100 µg
EUR 476
Anti-TSHB Antibody
STJ503424 100 µg
EUR 476
TSHB Antibody, HRP conjugated
1-CSB-PA11769B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TSHB Antibody, FITC conjugated
1-CSB-PA11769C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TSHB Antibody, Biotin conjugated
1-CSB-PA11769D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal TSHB Antibody (Center)
APR10580G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSHB (Center). This antibody is tested and proven to work in the following applications:
TSHB protein (His tag)
80R-3560 20 ug
EUR 327
Description: Purified recombinant TSHB protein (His tag)
Human TSHB ELISA Kit
ELA-E0463h 96 Tests
EUR 824
TSHB ELISA KIT|Human
EF000321 96 Tests
EUR 689
Rat TSHB shRNA Plasmid
20-abx985197
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TSHB shRNA Plasmid
20-abx954956
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TSHB Human Recombinant Protein
PROTP01222 Regular: 10ug
EUR 317
Description: TSHB Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 141 amino acids (21-138 a.a) and having a molecular mass of 15.9kDa.
TSHB Recombinant Protein (Rat)
RP234968 100 ug Ask for price
TSHB Recombinant Protein (Human)
RP033139 100 ug Ask for price
TSHB Recombinant Protein (Mouse)
RP181703 100 ug Ask for price
TSHB Recombinant Protein (Mouse)
RP181706 100 ug Ask for price
TSHB Recombinant Protein (Mouse)
RP181709 100 ug Ask for price
Mouse TSHB ELISA Kit
STJ150033 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Mouse serum, plasma and other biological fluids
Rat TSHB ELISA Kit
STJ150193 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Rat serum, plasma and other biological fluids
Human TSHB ELISA Kit
STJ150216 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in human serum, plasma and other biological fluids
Anti-TSHB Antibody (Biotin)
STJ503425 100 µg
EUR 586
Anti-TSHB Antibody (FITC)
STJ503426 100 µg
EUR 586
Anti-TSHB Antibody (Biotin)
STJ503427 100 µg
EUR 586
Anti-TSHB Antibody (FITC)
STJ503428 100 µg
EUR 586
Human Thyrotropin subunit beta (TSHB)
1-CSB-EP025130HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Thyrotropin subunit beta(TSHB) expressed in E.coli
Rat Thyrotropin subunit beta (Tshb)
1-CSB-EP025130RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in E.coli
Monoclonal TSHB Antibody, Clone: 1D12G1
APR10579G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TSHB. The antibodies are raised in Mouse and are from clone 1D12G1. This antibody is applicable in WB and IHC, FC, ICC, E
Rat Thyrotropin subunit beta (Tshb)
1-CSB-YP025130RA
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Yeast
Thyrotropin Subunit Beta (TSHB) Antibody
20-abx005202
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thyrotropin Subunit Beta (TSHB) Antibody
abx224242-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Thyrotropin Subunit Beta (TSHb) Antibody
20-abx103378
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Thyrotropin Subunit Beta (TSHB) Antibody
abx034029-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Thyrotropin Subunit Beta (TSHB) Antibody
abx034029-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Thyrotropin Subunit Beta (TSHB) Protein
20-abx263265
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Thyrotropin Subunit Beta (TSHB) Antibody
20-abx306505
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat Thyrotropin subunit beta (Tshb)
1-CSB-BP025130RA
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Baculovirus
TSHB Polyclonal Antibody, HRP Conjugated
A50685 100 µg
EUR 570.55
Description: The best epigenetics products
TSHB Polyclonal Antibody, FITC Conjugated
A50686 100 µg
EUR 570.55
Description: kits suitable for this type of research
TSHB Polyclonal Antibody, Biotin Conjugated
A50687 100 µg
EUR 570.55
Description: fast delivery possible
Tshb ORF Vector (Rat) (pORF)
ORF078324 1.0 ug DNA
EUR 506
TSHB ORF Vector (Human) (pORF)
ORF011047 1.0 ug DNA
EUR 95
Tshb ORF Vector (Mouse) (pORF)
ORF060569 1.0 ug DNA
EUR 506
Tshb ORF Vector (Mouse) (pORF)
ORF060570 1.0 ug DNA
EUR 506
Tshb ORF Vector (Mouse) (pORF)
ORF060571 1.0 ug DNA
EUR 506
TSHB ELISA Kit (Mouse) (OKCD00118)
OKCD00118 96 Wells
EUR 857
Description: Description of target: Indispensable for the control of thyroid structure and metabolism.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.9 pg/mL
TSHB ELISA Kit (Chicken) (OKEH07396)
OKEH07396 96 Wells
EUR 609
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086ng/mL