  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW7 antibody

70R-6541 50 ug
EUR 467
Description: Rabbit polyclonal FBXW7 antibody raised against the C terminal of FBXW7

FBXW7 Antibody

36334-100ul 100ul
EUR 252

FBXW7 Antibody

DF12400 200ul
EUR 304
Description: FBXW7 antibody detects endogenous levels of FBXW7.

FBXW7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FBXW7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300


YF-PA19671 50 ug
EUR 363
Description: Mouse polyclonal to FBXW7


YF-PA19672 100 ug
EUR 403
Description: Rabbit polyclonal to FBXW7


YF-PA26323 50 ul
EUR 334
Description: Mouse polyclonal to FBXW7

anti- FBXW7 antibody

FNab03057 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: F-box and WD repeat domain containing 7
  • Uniprot ID: Q969H0
  • Gene ID: 55294
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against FBXW7

FBXW7 Rabbit pAb

A5872-100ul 100 ul
EUR 308

FBXW7 Rabbit pAb

A5872-200ul 200 ul
EUR 459

FBXW7 Rabbit pAb

A5872-20ul 20 ul
EUR 183

FBXW7 Rabbit pAb

A5872-50ul 50 ul
EUR 223

FBXW7 Blocking Peptide

33R-5108 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW7 antibody, catalog no. 70R-6541

FBXW7 Blocking Peptide

DF12400-BP 1mg
EUR 195

FBXW7 cloning plasmid

CSB-CL822163HU-10ug 10ug
EUR 705
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2124
  • Sequence: atgaatcaggaactgctctctgtgggcagcaaaagacgacgaactggaggctctctgagaggtaacccttcctcaagccaggtagatgaagaacagatgaatcgtgtggtagaggaggaacagcaacagcaactcagacaacaagaggaggagcacactgcaaggaatggtgaag
  • Show more
Description: A cloning plasmid for the FBXW7 gene.

Anti-FBXW7 antibody

PAab03057 100 ug
EUR 412

pDONR223-FBXW7 Plasmid

PVTB00367 2 ug
EUR 356

Anti-FBXW7 antibody

STJ29923 100 µl
EUR 277
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Fbxw7 (1C11)

YF-MA18764 100 ug
EUR 363
Description: Mouse monoclonal to Fbxw7

Anti-FBXW7 (3D1)

YF-MA11557 100 ug
EUR 363
Description: Mouse monoclonal to FBXW7

Mouse FBXW7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009598 96 Tests
EUR 689

Human FBXW7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW7 Recombinant Protein (Human)

RP039052 100 ug Ask for price

pECMV- 3*Flag- FBXW7

PVT10356 2 ug
EUR 301

FBXW7 Recombinant Protein (Mouse)

RP134159 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134162 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134165 100 ug Ask for price

Polyclonal Fbxw7 antibody - middle region

APR00709G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fbxw7 - middle region. This antibody is tested and proven to work in the following applications:

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044721 1.0 ug DNA
EUR 506

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044722 1.0 ug DNA
EUR 506

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044723 1.0 ug DNA
EUR 506

FBXW7 ORF Vector (Human) (pORF)

ORF013018 1.0 ug DNA
EUR 95

Polyclonal FBXW7 / FBW7 Antibody (N-Terminus)

APR02668G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FBXW7 / FBW7 (N-Terminus). This antibody is tested and proven to work in the following applications:

FBXW7 sgRNA CRISPR Lentivector set (Human)

K0767601 3 x 1.0 ug
EUR 339

Fbxw7 sgRNA CRISPR Lentivector set (Mouse)

K4531701 3 x 1.0 ug
EUR 339

Monoclonal FBXW7 Antibody (monoclonal) (M02), Clone: 3D1

AMM03534G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FBXW7 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3D1. This antibody is applicable in WB and IHC, E

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767602 1.0 ug DNA
EUR 154

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767603 1.0 ug DNA
EUR 154

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767604 1.0 ug DNA
EUR 154

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4531702 1.0 ug DNA
EUR 154

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4531703 1.0 ug DNA
EUR 154

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4531704 1.0 ug DNA
EUR 154

FBXW7 Protein Vector (Human) (pPB-C-His)

PV052069 500 ng
EUR 481

FBXW7 Protein Vector (Human) (pPB-N-His)

PV052070 500 ng
EUR 481

FBXW7 Protein Vector (Human) (pPM-C-HA)

PV052071 500 ng
EUR 481

FBXW7 Protein Vector (Human) (pPM-C-His)

PV052072 500 ng
EUR 481

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178882 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178883 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178884 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178885 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178886 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178887 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178888 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178889 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178890 500 ng
EUR 603

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178891 500 ng
EUR 603

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178892 500 ng
EUR 603

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178893 500 ng
EUR 603

Fbxw7 3'UTR GFP Stable Cell Line

TU156466 1.0 ml Ask for price

FBXW7 3'UTR Luciferase Stable Cell Line

TU007813 1.0 ml
EUR 1521

Fbxw7 3'UTR Luciferase Stable Cell Line

TU106466 1.0 ml Ask for price

FBXW7 3'UTR GFP Stable Cell Line

TU057813 1.0 ml
EUR 1521

Human F-box/WD repeat-containing protein 7 (FBXW7)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 83.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human F-box/WD repeat-containing protein 7(FBXW7) expressed in in vitro E.coli expression system