ST3GAL5 antibody
70R-1878 100 ug
EUR 377
Description: Rabbit polyclonal ST3GAL5 antibody raised against the N terminal of ST3GAL5
ST3GAL5 antibody
70R-20549 50 ul
EUR 435
Description: Rabbit polyclonal ST3GAL5 antibody
ST3GAL5 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ST3GAL5. Recognizes ST3GAL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
ST3GAL5 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ST3GAL5. Recognizes ST3GAL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
ST3GAL5 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ST3GAL5. Recognizes ST3GAL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA25215 50 ul
EUR 334
Description: Mouse polyclonal to ST3GAL5
ST3GAL5 Polyclonal Antibody
31384-100ul 100ul
EUR 252
ST3GAL5 Polyclonal Antibody
31384-50ul 50ul
EUR 187
ST3GAL5 Blocking Peptide
33R-2160 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST3GAL5 antibody, catalog no. 70R-1878
Human ST3GAL5 Antibody
32904-05111 150 ug
EUR 261
ST3GAL5 cloning plasmid
CSB-CL890769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgccaagtgagtacacctatgtgaaactgagaagtgattgctcgaggccttccctgcaatggtacacccgagctcaaagcaagatgagaaggcccagcttgttattaaaagacatcctcaaatgtacattgcttgtgtttggagtgtggatcctttatatcctcaagttaaatt
  • Show more
Description: A cloning plasmid for the ST3GAL5 gene.
ST3GAL5 Rabbit pAb
A7947-100ul 100 ul
EUR 308
ST3GAL5 Rabbit pAb
A7947-200ul 200 ul
EUR 459
ST3GAL5 Rabbit pAb
A7947-20ul 20 ul
EUR 183
ST3GAL5 Rabbit pAb
A7947-50ul 50 ul
EUR 223
anti- ST3GAL5 antibody
FNab08266 100µg
EUR 548.75
  • Immunogen: ST3 beta-galactoside alpha-2,3-sialyltransferase 5
  • Uniprot ID: Q9UNP4
  • Gene ID: 8869
  • Research Area: Metabolism
Description: Antibody raised against ST3GAL5
Anti-ST3GAL5 antibody
PAab08266 100 ug
EUR 386
Anti-ST3GAL5 antibody
STJ110256 100 µl
EUR 277
Description: Ganglioside GM3 is known to participate in the induction of cell differentiation, modulation of cell proliferation, maintenance of fibroblast morphology, signal transduction, and integrin-mediated cell adhesion. The protein encoded by this gene is a type II membrane protein which catalyzes the formation of GM3 using lactosylceramide as the substrate. The encoded protein is a member of glycosyltransferase family 29 and may be localized to the Golgi apparatus. Mutation in this gene has been associated with Amish infantile epilepsy syndrome. Transcript variants encoding different isoforms have been found for this gene.
ST3GAL5 protein (His tag)
80R-3551 100 ug
EUR 327
Description: Purified recombinant ST3GAL5 protein (His tag)
Mouse St3gal5 ELISA KIT
ELI-19160m 96 Tests
EUR 865
EF003264 96 Tests
EUR 689
Mouse ST3GAL5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat ST3GAL5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST3GAL5 Polyclonal Conjugated Antibody
C31384 100ul
EUR 397
Human ST3GAL5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-39360b 96 Tests
EUR 928
ELI-40992h 96 Tests
EUR 824
ST3GAL5 Recombinant Protein (Rat)
RP231245 100 ug Ask for price
ST3GAL5 Recombinant Protein (Human)
RP030229 100 ug Ask for price
ST3GAL5 Recombinant Protein (Mouse)
RP175763 100 ug Ask for price
ST3GAL5 Recombinant Protein (Mouse)
RP175766 100 ug Ask for price
Human ST3GAL5 Antibody (Biotin Conjugate)
32904-05121 150 ug
EUR 369
Polyclonal ST3GAL5 Antibody (C-term)
APR14410G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ST3GAL5 (C-term). This antibody is tested and proven to work in the following applications:
St3gal5 ORF Vector (Rat) (pORF)
ORF077083 1.0 ug DNA
EUR 506
ST3GAL5 ORF Vector (Human) (pORF)
ORF010077 1.0 ug DNA
EUR 95
St3gal5 ORF Vector (Mouse) (pORF)
ORF058589 1.0 ug DNA
EUR 506
St3gal5 ORF Vector (Mouse) (pORF)
ORF058590 1.0 ug DNA
EUR 506
Human ST3GAL5 AssayLite Antibody (FITC Conjugate)
32904-05141 150 ug
EUR 428
Human ST3GAL5 AssayLite Antibody (RPE Conjugate)
32904-05151 150 ug
EUR 428
Human ST3GAL5 AssayLite Antibody (APC Conjugate)
32904-05161 150 ug
EUR 428
Human ST3GAL5 AssayLite Antibody (PerCP Conjugate)
32904-05171 150 ug
EUR 471
St3gal5 sgRNA CRISPR Lentivector set (Rat)
K7075601 3 x 1.0 ug
EUR 339
St3gal5 sgRNA CRISPR Lentivector set (Mouse)
K3682201 3 x 1.0 ug
EUR 339
ST3GAL5 sgRNA CRISPR Lentivector set (Human)
K2294501 3 x 1.0 ug
EUR 339
St3gal5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7075602 1.0 ug DNA
EUR 154
St3gal5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7075603 1.0 ug DNA
EUR 154
St3gal5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7075604 1.0 ug DNA
EUR 154
St3gal5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3682202 1.0 ug DNA
EUR 154
St3gal5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3682203 1.0 ug DNA
EUR 154
St3gal5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3682204 1.0 ug DNA
EUR 154
ST3GAL5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2294502 1.0 ug DNA
EUR 154
ST3GAL5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2294503 1.0 ug DNA
EUR 154
ST3GAL5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2294504 1.0 ug DNA
EUR 154
ST3GAL5 Protein Vector (Rat) (pPB-C-His)
PV308330 500 ng
EUR 603
ST3GAL5 Protein Vector (Rat) (pPB-N-His)
PV308331 500 ng
EUR 603
ST3GAL5 Protein Vector (Rat) (pPM-C-HA)
PV308332 500 ng
EUR 603
ST3GAL5 Protein Vector (Rat) (pPM-C-His)
PV308333 500 ng
EUR 603
ST3GAL5 Protein Vector (Human) (pPB-C-His)
PV040305 500 ng
EUR 329
ST3GAL5 Protein Vector (Human) (pPB-N-His)
PV040306 500 ng
EUR 329
ST3GAL5 Protein Vector (Human) (pPM-C-HA)
PV040307 500 ng
EUR 329
ST3GAL5 Protein Vector (Human) (pPM-C-His)
PV040308 500 ng
EUR 329
ST3GAL5 Protein Vector (Mouse) (pPB-C-His)
PV234354 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPB-N-His)
PV234355 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPM-C-HA)
PV234356 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPM-C-His)
PV234357 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPB-C-His)
PV234358 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPB-N-His)
PV234359 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPM-C-HA)
PV234360 500 ng
EUR 603
ST3GAL5 Protein Vector (Mouse) (pPM-C-His)
PV234361 500 ng
EUR 603
Recombinant Human ST3GAL5 Protein, His, E.coli-1mg
QP13602-1mg 1mg
EUR 2757
Recombinant Human ST3GAL5 Protein, His, E.coli-20ug
QP13602-20ug 20ug
EUR 201
Recombinant Human ST3GAL5 Protein, His, E.coli-5ug
QP13602-5ug 5ug
EUR 155
St3gal5 3'UTR Luciferase Stable Cell Line
TU119772 1.0 ml Ask for price
St3gal5 3'UTR GFP Stable Cell Line
TU169772 1.0 ml Ask for price
St3gal5 3'UTR Luciferase Stable Cell Line
TU221241 1.0 ml Ask for price
ST3GAL5 3'UTR GFP Stable Cell Line
TU074705 1.0 ml
EUR 1521
St3gal5 3'UTR GFP Stable Cell Line
TU271241 1.0 ml Ask for price
ST3GAL5 3'UTR Luciferase Stable Cell Line
TU024705 1.0 ml
EUR 1521
ST3GAL5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV694261 1.0 ug DNA
EUR 682
ST3GAL5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV694265 1.0 ug DNA
EUR 682
ST3GAL5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV694266 1.0 ug DNA
EUR 682
ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 5 (ST3GAL5) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.