EEF1A1

EEF1A1 siRNA

20-abx901642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1A1 siRNA

20-abx914974
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1A1 siRNA

20-abx914975
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1A1 Antibody

ABD6156 100 ug
EUR 438

eEF1A1 Antibody

49856-100ul 100ul
EUR 333

eEF1A1 Antibody

49856-50ul 50ul
EUR 239

EEF1A1 Antibody

32103-100ul 100ul
EUR 252

EEF1A1 antibody

70R-17000 50 ul
EUR 435
Description: Rabbit polyclonal EEF1A1 antibody

EEF1A1 antibody

70R-1029 100 ug
EUR 377
Description: Rabbit polyclonal EEF1A1 antibody raised against the C terminal of EEF1A1

EEF1A1 Antibody

DF6156 200ul
EUR 304
Description: EEF1A1 Antibody detects endogenous levels of total EEF1A1.

EEF1A1 Antibody

1-CSB-PA007409GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF1A1 Antibody

1-CSB-PA007409LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-eEF1A1

YF-PA23621 50 ul
EUR 334
Description: Mouse polyclonal to eEF1A1

eEF1A1 Conjugated Antibody

C49856 100ul
EUR 397

EEF1A1 Conjugated Antibody

C32103 100ul
EUR 397

EEF1A1 cloning plasmid

CSB-CL007409HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctggg
  • Show more
Description: A cloning plasmid for the EEF1A1 gene.

anti- EEF1A1 antibody

FNab02641 100µg
EUR 548.75
  • Immunogen: eukaryotic translation elongation factor 1 alpha 1
  • Uniprot ID: P68104
  • Gene ID: 1915
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF1A1

eEF1A1 Rabbit mAb

A11545-100ul 100 ul
EUR 410

eEF1A1 Rabbit mAb

A11545-200ul 200 ul
EUR 571

eEF1A1 Rabbit mAb

A11545-20ul 20 ul
EUR 221

eEF1A1 Rabbit mAb

A11545-50ul 50 ul
EUR 287

EEF1A1 Rabbit pAb

A0831-100ul 100 ul
EUR 308

EEF1A1 Rabbit pAb

A0831-200ul 200 ul
EUR 459

EEF1A1 Rabbit pAb

A0831-20ul 20 ul Ask for price

EEF1A1 Rabbit pAb

A0831-50ul 50 ul Ask for price

EEF1A1 Rabbit pAb

A0974-100ul 100 ul
EUR 308

EEF1A1 Rabbit pAb

A0974-200ul 200 ul
EUR 459

EEF1A1 Rabbit pAb

A0974-20ul 20 ul
EUR 183

EEF1A1 Rabbit pAb

A0974-50ul 50 ul
EUR 223

EEF1A1 Rabbit pAb

A17857-100ul 100 ul
EUR 308

EEF1A1 Rabbit pAb

A17857-200ul 200 ul
EUR 459

EEF1A1 Rabbit pAb

A17857-20ul 20 ul
EUR 183

EEF1A1 Rabbit pAb

A17857-50ul 50 ul
EUR 223

EEF1A1 Blocking Peptide

33R-4196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1A1 antibody, catalog no. 70R-1029

Human EEF1A1 Antibody

35679-05111 150 ug
EUR 261

EEF1A1 Blocking Peptide

DF6156-BP 1mg
EUR 195

Anti-EEF1A1 antibody

PAab02641 100 ug
EUR 386

pCMV-SPORT6-EEF1A1

PVT13636 2 ug
EUR 391

Anti-EEF1A1 antibody

STJ111034 100 µl
EUR 277
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody

STJ23475 100 µl
EUR 277
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody

STJ119870 100 µl
EUR 277
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Rat EEF1A1 shRNA Plasmid

20-abx987742
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EEF1A1 ELISA Kit

ELA-E11476h 96 Tests
EUR 824

EEF1A1 ELISA KIT|Human

EF003718 96 Tests
EUR 689

EEF1A1 / EEF1A2 / EEF1A1P5 Antibody

20-abx327705
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human EEF1A1 shRNA Plasmid

20-abx951332
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EEF1A1 protein (His tag)

80R-3746 100 ug
EUR 349
Description: Purified recombinant EEF1A1 protein (His tag)

eEF1A1 recombinant monoclonal antibody

A5854 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human eEF1A1 for WB, IHC,ELISA

Mouse EEF1A1 shRNA Plasmid

20-abx970113
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Acetyl-EEF1A1 (K41) Antibody

1-CSB-PA000115
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-EEF1A1 (K41). Recognizes Acetyl-EEF1A1 (K41) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A1/EEF1A2/EEF1A1P5 Antibody

1-CSB-PA005918
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1A1/EEF1A2/EEF1A1P5. Recognizes EEF1A1/EEF1A2/EEF1A1P5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A1 Antibody, HRP conjugated

1-CSB-PA007409LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, FITC conjugated

1-CSB-PA007409LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, Biotin conjugated

1-CSB-PA007409LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EEF1A1 Recombinant Protein (Human)

RP010192 100 ug Ask for price

EEF1A1 Recombinant Protein (Rat)

RP199079 100 ug Ask for price

EEF1A1 Recombinant Protein (Mouse)

RP130895 100 ug Ask for price

Polyclonal EEF1A1 Antibody (N-term)

APR05771G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal EEF1A1 Antibody (C-term)

APR05772G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (C-term). This antibody is tested and proven to work in the following applications:

Human EEF1A1 Antibody (Biotin Conjugate)

35679-05121 150 ug
EUR 369

EEF1A1 ORF Vector (Human) (pORF)

ORF003398 1.0 ug DNA
EUR 95

Eef1a1 ORF Vector (Rat) (pORF)

ORF066361 1.0 ug DNA
EUR 506

Eef1a1 ORF Vector (Mouse) (pORF)

ORF043633 1.0 ug DNA
EUR 506

EEF1A1 ELISA Kit (Human) (OKCD08740)

OKCD08740 96 Wells
EUR 975
Description: Description of target: EEF1A1 is an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome.This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

EEF1A1 ELISA Kit (Mouse) (OKEH05651)

OKEH05651 96 Wells
EUR 779
Description: Description of target: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis. With PARP1 and TXK, forms a complex that acts as a T helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFN-gamma to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

EEF1A1 ELISA Kit (Bovine) (OKEH07735)

OKEH07735 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

EEF1A1 sgRNA CRISPR Lentivector set (Human)

K0654801 3 x 1.0 ug
EUR 339

Human EEF1A1 AssayLite Antibody (FITC Conjugate)

35679-05141 150 ug
EUR 428

Human EEF1A1 AssayLite Antibody (RPE Conjugate)

35679-05151 150 ug
EUR 428

Human EEF1A1 AssayLite Antibody (APC Conjugate)

35679-05161 150 ug
EUR 428