Human GML(Glycosylphosphatidylinositol Anchored Molecule Like Protein) ELISA Kit


Human GML(Glycosylphosphatidylinositol Anchored Molecule Like Protein) ELISA Kit 

Order Now:

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RDR-GML-Hu-48Tests 48 Tests
EUR 544

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RDR-GML-Hu-96Tests 96 Tests
EUR 756

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RD-GML-Hu-48Tests 48 Tests
EUR 521

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RD-GML-Hu-96Tests 96 Tests
EUR 723

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99445
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Glycosylphosphatidylinositol Anchored Molecule Like Protein expressed in: E.coli

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)ELISA Kit

201-12-2723 96 tests
EUR 440
  • This Glycosylphosphatidylinositol Anchored Molecule Like Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

abx570812-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein(GML)ELISA Kit

QY-E04903 96T
EUR 361

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glycosylphosphatidylinositol Anchored Molecule Like Protein elisa. Alternative names of the recognized antigen: LY6DL
  • GPI Anchored Molecule Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human GML (Glycosylphosphatidylinositol Anchored Molecule Like Protein)

ELK3290 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-
  • Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Anchored Molecule Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with APC.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with Biotin.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with Cy3.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with FITC.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with HRP.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with PE.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GML (Met21~Pro158)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with APC-Cy7.

Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored

EF015079 96 Tests
EUR 689

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

EUR 554
  • Should the Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

EUR 725
  • Should the Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1(GPIHBP1)ELISA Kit

QY-E03408 96T
EUR 361

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RDR-GPIHBP1-Hu-48Tests 48 Tests
EUR 589

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RDR-GPIHBP1-Hu-96Tests 96 Tests
EUR 820

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RD-GPIHBP1-Hu-48Tests 48 Tests
EUR 563

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

RD-GPIHBP1-Hu-96Tests 96 Tests
EUR 783

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

SEM435Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

SEM435Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

SEM435Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

SEM435Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 elisa. Alternative names of the recognized antigen: GPI-HBP1
  • High density lipoprotein-binding protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human GPIHBP1 (Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1)

ELK6567 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1). Standards or samples are then added to the appropriate microtiter p
  • Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit

abx389446-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


ELI-31790h 96 Tests
EUR 824

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GML ELISA Kit (Human) (OKCD00518)

OKCD00518 96 Wells
EUR 831
Description: Description of target: May play a role in the apoptotic pathway or cell-cycle regulation induced by p53/TP53 after DNA damage. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

GML ELISA Kit (Human) (OKDD00286)

OKDD00286 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

GML Recombinant Protein (Human)

RP039502 100 ug Ask for price

Human Resistin like molecule β ELISA kit

E01R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resistin like molecule β ELISA kit

E01R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resistin like molecule β ELISA kit

E01R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA23786 50 ul
EUR 334
Description: Mouse polyclonal to GML

CD5 Molecule-Like Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GML Recombinant Protein (Mouse)

RP138860 100 ug Ask for price

Human GML shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit

abx387626-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human CD300LB/ CMRF35-like molecule 7 ELISA Kit

E0416Hu 1 Kit
EUR 605

Human CMRF35 like molecule 8(CD300A) ELISA kit

E01C1477-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 8(CD300A) ELISA kit

E01C1477-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 8(CD300A) ELISA kit

E01C1477-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 6(CD300C) ELISA kit

E01C1478-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 6(CD300C) ELISA kit

E01C1478-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 6(CD300C) ELISA kit

E01C1478-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit

E01C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit

E01C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit

E01C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 7(CD300LB) ELISA kit

E01C1480-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 7(CD300LB) ELISA kit

E01C1480-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 7(CD300LB) ELISA kit

E01C1480-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 4(CD300LD) ELISA kit

E01C1481-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 4(CD300LD) ELISA kit

E01C1481-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 4(CD300LD) ELISA kit

E01C1481-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 1(CD300LF) ELISA kit

E01C1482-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 1(CD300LF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 1(CD300LF) ELISA kit

E01C1482-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 1(CD300LF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 1(CD300LF) ELISA kit

E01C1482-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 1(CD300LF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 9(CD300LG) ELISA kit

E01C1483-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 9(CD300LG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 9(CD300LG) ELISA kit

E01C1483-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 9(CD300LG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 9(CD300LG) ELISA kit

E01C1483-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 9(CD300LG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CMRF35-like molecule 7

EK3115 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CMRF35-like molecule 7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD300LB(CMRF35-like molecule 7) ELISA Kit

EH1453 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: A8K4G0
  • Alias: CD300LB/CMRF35-like molecule 7/CLM-7/Triggering receptor expressed on myeloid cells 5/TREM-5/Leukocyte mono-Ig-like receptor 5/Immune receptor expressed on myeloid cells 3/IREM-3/CD300 antigen-
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human CMRF35- like molecule 2, CD300E ELISA KIT

ELI-10372h 96 Tests
EUR 824

Human CMRF35- like molecule 9, CD300LG ELISA KIT

ELI-10607h 96 Tests
EUR 824

Human Junctional adhesion molecule- like, AMICA1 ELISA KIT

ELI-19682h 96 Tests
EUR 824

Human CMRF35- like molecule 8, CD300A ELISA KIT

ELI-25610h 96 Tests
EUR 824

Human CMRF35- like molecule 4, CD300LD ELISA KIT

ELI-25814h 96 Tests
EUR 824

Human CMRF35- like molecule 6, CD300C ELISA KIT

ELI-26336h 96 Tests
EUR 824

Human CMRF35- like molecule 1, CD300LF ELISA KIT

ELI-46811h 96 Tests
EUR 824

Human CMRF35-like molecule 7(CD300LB) ELISA kit

CSB-EL004919HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CMRF35-like molecule 7 (CD300LB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CMRF35-like molecule 7(CD300LB) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CMRF35-like molecule 7(CD300LB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Junction Adhesion Molecule Like (JAML) ELISA Kit

abx388054-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human CMRF35- like molecule 7, CD300LB ELISA KIT

ELI-50988h 96 Tests
EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

GML cloning plasmid

CSB-CL860340HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 477
  • Sequence: atgctcctctttgccttactcctagccatggagctcccattggtggcagccagtgccaccatgcgcgctcagtggacttacagtttgagatgccatgactgtgcggtcataaatgacttcaactgtcccaacattagagtatgtccgtatcatattaggcgctgtatgacaatctc
  • Show more
Description: A cloning plasmid for the GML gene.

Anti-GML (5F4)

YF-MA13268 100 ug
EUR 363
Description: Mouse monoclonal to GML

Anti-GML (1E7)

YF-MA13269 100 ug
EUR 363
Description: Mouse monoclonal to GML

Rabbit Resistin like molecule β ELISA kit

E04R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Resistin like molecule β ELISA kit

E04R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Resistin like molecule β ELISA kit

E04R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Resistin like molecule β ELISA kit

E02R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Resistin like molecule β ELISA kit

E02R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Resistin like molecule β ELISA kit

E02R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Resistin like molecule β ELISA kit

E03R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Resistin like molecule β ELISA kit

E03R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Resistin like molecule β ELISA kit

E03R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Resistin like molecule β ELISA kit

E06R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Resistin like molecule β ELISA kit

E06R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Resistin like molecule β ELISA kit

E06R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Resistin like molecule β ELISA kit

E08R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Resistin like molecule β ELISA kit

E08R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Resistin like molecule β ELISA kit

E08R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Resistin like molecule β ELISA kit

E09R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Resistin like molecule β ELISA kit

E09R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Resistin like molecule β ELISA kit

E09R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Resistin like molecule β ELISA kit

E07R0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Resistin like molecule β ELISA kit

E07R0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Resistin like molecule β ELISA kit

E07R0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CMRF35- like molecule, Clm ELISA KIT

ELI-25927m 96 Tests
EUR 865

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DLR-GPLD1-Hu-48T 48T
EUR 517
  • Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DLR-GPLD1-Hu-96T 96T
EUR 673
  • Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx250820-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 ELISA Kit (GPLD1)

RK01496 96 Tests
EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-48Tests 48 Tests
EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-96Tests 96 Tests
EUR 756

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RD-GPLD1-Hu-48Tests 48 Tests
EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RD-GPLD1-Hu-96Tests 96 Tests
EUR 723

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glycosylphosphatidylinositol Specific Phospholipase D1 elisa. Alternative names of the recognized antigen: GPIPLD
  • Glycoprotein phospholipase D
  • Glycosyl-phosphatidylinositol-specific phospholipase D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

CD5 Molecule-Like, HEK Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Human Resistin-like Molecule β (RELM-β) ELISA Kit

CSB-E13852h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Resistin-like Molecule β (RELM-β) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Resistin-like Molecule β (RELM-β) ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Resistin-like Molecule β (RELM-β) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human CMRF35-Like Molecule 1 / IREM1 (CD300LF) ELISA Kit

abx386392-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human CMRF35-Like Molecule 9 / TREM4 (CD300LG) ELISA Kit

abx386393-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GML ORF Vector (Human) (pORF)

ORF013168 1.0 ug DNA
EUR 354

Human Neural cell adhesion molecule L1-like protein(CHL1) ELISA kit

CSB-EL005355HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neural cell adhesion molecule L1-like protein (CHL1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neural cell adhesion molecule L1-like protein(CHL1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neural cell adhesion molecule L1-like protein(CHL1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

CD5L CD5 Molecule-Like Human Recombinant Protein

PROTO43866 Regular: 10ug
EUR 317
Description: CD5L Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (a.a 20-347) containing 337 amino acids including a 9 a.a N-terminal His tag. The total molecular mass is 37.2kDa (calculated).

Gpaa1 ELISA Kit| Mouse Glycosylphosphatidylinositol anchor atta

EF015090 96 Tests
EUR 689

GML Protein Vector (Human) (pPB-C-His)

PV052669 500 ng
EUR 481

GML Protein Vector (Human) (pPB-N-His)

PV052670 500 ng
EUR 481

GML Protein Vector (Human) (pPM-C-HA)

PV052671 500 ng
EUR 481

GML Protein Vector (Human) (pPM-C-His)

PV052672 500 ng
EUR 481

Mouse Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit

abx389456-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)

E-EL-H0397 1 plate of 96 wells
EUR 534
  • Gentaur's GPLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)

ELK3447 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
  • Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Specific Phospholipase D1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat CMRF35 like molecule 8(CD300A) ELISA kit

E02C1477-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 8(CD300A) ELISA kit

E02C1477-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 8(CD300A) ELISA kit

E02C1477-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 6(CD300C) ELISA kit

E02C1478-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 6(CD300C) ELISA kit

E02C1478-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 6(CD300C) ELISA kit

E02C1478-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit

E02C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit

E02C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit

E02C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 7(CD300LB) ELISA kit

E02C1480-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 7(CD300LB) ELISA kit

E02C1480-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 7(CD300LB) ELISA kit

E02C1480-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 4(CD300LD) ELISA kit

E02C1481-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 4(CD300LD) ELISA kit

E02C1481-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 4(CD300LD) ELISA kit

E02C1481-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.