NRN1L siRNA
20-abx926412	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRN1L siRNA
20-abx926413	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRN1L Polyclonal Antibody
29898-100ul	SAB	100ul	EUR 252

NRN1L Polyclonal Antibody
29898-50ul	SAB	50ul	EUR 187

NRN1L cloning plasmid
CSB-CL670967HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 498 Sequence: ATGATGCGCTGCTGCCGCCGCCGCTGCTGCTGCCGGCAACCACCCCATGCCCTGAGGCCGTTGCTGTTGCTGCCCCTCGTCCTTTTACCTCCCCTGGCAGCAGCTGCAGCGGGCCCAAACCGATGTGACACCATATACCAGGGCTTCGCCGAGTGTCTCATCCGCTTGGGGGACAG Show more
Description: A cloning plasmid for the NRN1L gene.

NRN1L Polyclonal Antibody
A64986	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NRN1L Rabbit pAb
A16594-100ul	Abclonal	100 ul	EUR 308

NRN1L Rabbit pAb
A16594-200ul	Abclonal	200 ul	EUR 459

NRN1L Rabbit pAb
A16594-20ul	Abclonal	20 ul	EUR 183

NRN1L Rabbit pAb
A16594-50ul	Abclonal	50 ul	EUR 223

Anti-NRN1L antibody
STJ119033	St John's Laboratory	100 µl	EUR 277

NRN1L Antibody, HRP conjugated
1-CSB-PA670967LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1L. Recognizes NRN1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRN1L Antibody, FITC conjugated
1-CSB-PA670967LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1L. Recognizes NRN1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRN1L Antibody, Biotin conjugated
1-CSB-PA670967LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1L. Recognizes NRN1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NRN1L ELISA KIT|Human
EF005334	Lifescience Market	96 Tests	EUR 689

Human NRN1L shRNA Plasmid
20-abx964745	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NRN1L Polyclonal Conjugated Antibody
C29898	SAB	100ul	EUR 397

Mouse NRN1L shRNA Plasmid
20-abx982150	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NRN1L Recombinant Protein (Human)
RP041755	ABM	100 ug	Ask for price

NRN1L Recombinant Protein (Mouse)
RP155054	ABM	100 ug	Ask for price

NRN1L Recombinant Protein (Rat)
RP214562	ABM	100 ug	Ask for price

Neuritin-Like Protein (NRN1L) Antibody
abx027102-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody
abx027102-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody
20-abx301402	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NRN1L Polyclonal Antibody, HRP Conjugated
A64987	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NRN1L Polyclonal Antibody, FITC Conjugated
A64988	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

NRN1L Polyclonal Antibody, Biotin Conjugated
A64989	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Nrn1l ORF Vector (Rat) (pORF)
ORF071522	ABM	1.0 ug DNA	EUR 506

NRN1L ORF Vector (Human) (pORF)
ORF013919	ABM	1.0 ug DNA	EUR 354

Nrn1l ORF Vector (Mouse) (pORF)
ORF051686	ABM	1.0 ug DNA	EUR 506

Neuritin-Like Protein (NRN1L) Antibody (HRP)
20-abx307272	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody (FITC)
20-abx307273	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody (Biotin)
20-abx307274	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nrn1l sgRNA CRISPR Lentivector set (Rat)
K6055201	ABM	3 x 1.0 ug	EUR 339

Nrn1l sgRNA CRISPR Lentivector set (Mouse)
K3136801	ABM	3 x 1.0 ug	EUR 339

NRN1L sgRNA CRISPR Lentivector set (Human)
K1456001	ABM	3 x 1.0 ug	EUR 339

Mouse Neuritin- like protein, Nrn1l ELISA KIT
ELI-22406m	Lifescience Market	96 Tests	EUR 865

Human Neuritin-like protein (NRN1L) ELISA Kit
abx385206-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Neuritin-like protein (NRN1L) ELISA Kit
abx390008-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Nrn1l sgRNA CRISPR Lentivector (Rat) (Target 1)
K6055202	ABM	1.0 ug DNA	EUR 154

Nrn1l sgRNA CRISPR Lentivector (Rat) (Target 2)
K6055203	ABM	1.0 ug DNA	EUR 154

Nrn1l sgRNA CRISPR Lentivector (Rat) (Target 3)
K6055204	ABM	1.0 ug DNA	EUR 154

Human Neuritin- like protein, NRN1L ELISA KIT
ELI-36828h	Lifescience Market	96 Tests	EUR 824

Nrn1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3136802	ABM	1.0 ug DNA	EUR 154

Nrn1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3136803	ABM	1.0 ug DNA	EUR 154

Nrn1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3136804	ABM	1.0 ug DNA	EUR 154

NRN1L sgRNA CRISPR Lentivector (Human) (Target 1)
K1456002	ABM	1.0 ug DNA	EUR 154

NRN1L sgRNA CRISPR Lentivector (Human) (Target 2)
K1456003	ABM	1.0 ug DNA	EUR 154

NRN1L sgRNA CRISPR Lentivector (Human) (Target 3)
K1456004	ABM	1.0 ug DNA	EUR 154

NRN1L Protein Vector (Rat) (pPB-C-His)
PV286086	ABM	500 ng	EUR 603

NRN1L Protein Vector (Rat) (pPB-N-His)
PV286087	ABM	500 ng	EUR 603

NRN1L Protein Vector (Rat) (pPM-C-HA)
PV286088	ABM	500 ng	EUR 603

NRN1L Protein Vector (Rat) (pPM-C-His)
PV286089	ABM	500 ng	EUR 603

NRN1L Protein Vector (Mouse) (pPB-C-His)
PV206742	ABM	500 ng	EUR 603

NRN1L Protein Vector (Mouse) (pPB-N-His)
PV206743	ABM	500 ng	EUR 603

NRN1L Protein Vector (Mouse) (pPM-C-HA)
PV206744	ABM	500 ng	EUR 603

NRN1L Protein Vector (Mouse) (pPM-C-His)
PV206745	ABM	500 ng	EUR 603

NRN1L Protein Vector (Human) (pPB-C-His)
PV055673	ABM	500 ng	EUR 481

NRN1L Protein Vector (Human) (pPB-N-His)
PV055674	ABM	500 ng	EUR 481

NRN1L Protein Vector (Human) (pPM-C-HA)
PV055675	ABM	500 ng	EUR 481

NRN1L Protein Vector (Human) (pPM-C-His)
PV055676	ABM	500 ng	EUR 481

Nrn1l 3'UTR Luciferase Stable Cell Line
TU114331	ABM	1.0 ml	Ask for price

Nrn1l 3'UTR GFP Stable Cell Line
TU164331	ABM	1.0 ml	Ask for price

Nrn1l 3'UTR Luciferase Stable Cell Line
TU214199	ABM	1.0 ml	Ask for price

Nrn1l 3'UTR GFP Stable Cell Line
TU264199	ABM	1.0 ml	Ask for price

NRN1L 3'UTR GFP Stable Cell Line
TU065980	ABM	1.0 ml	EUR 1394

NRN1L 3'UTR Luciferase Stable Cell Line
TU015980	ABM	1.0 ml	EUR 1394

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV651079	ABM	1.0 ug DNA	EUR 514

NRN1L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV651083	ABM	1.0 ug DNA	EUR 514

NRN1L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV651084	ABM	1.0 ug DNA	EUR 514

Nrn1l ELISA Kit| Mouse Neuritin-like protein ELISA Kit
EF015647	Lifescience Market	96 Tests	EUR 689

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6055205	ABM	3 x 1.0 ug	EUR 376

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3136805	ABM	3 x 1.0 ug	EUR 376

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1456005	ABM	3 x 1.0 ug	EUR 376

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6055206	ABM	1.0 ug DNA	EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6055207	ABM	1.0 ug DNA	EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6055208	ABM	1.0 ug DNA	EUR 167

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV651080	ABM	1.0 ug DNA	EUR 514

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV651081	ABM	1.0 ug DNA	EUR 572

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV651082	ABM	1.0 ug DNA	EUR 572

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3136806	ABM	1.0 ug DNA	EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3136807	ABM	1.0 ug DNA	EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3136808	ABM	1.0 ug DNA	EUR 167

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1456006	ABM	1.0 ug DNA	EUR 167

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1456007	ABM	1.0 ug DNA	EUR 167

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1456008	ABM	1.0 ug DNA	EUR 167