NRN1L

NRN1L siRNA

20-abx926412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRN1L siRNA

20-abx926413
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRN1L Polyclonal Antibody

29898-100ul 100ul
EUR 252

NRN1L Polyclonal Antibody

29898-50ul 50ul
EUR 187

NRN1L cloning plasmid

CSB-CL670967HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: ATGATGCGCTGCTGCCGCCGCCGCTGCTGCTGCCGGCAACCACCCCATGCCCTGAGGCCGTTGCTGTTGCTGCCCCTCGTCCTTTTACCTCCCCTGGCAGCAGCTGCAGCGGGCCCAAACCGATGTGACACCATATACCAGGGCTTCGCCGAGTGTCTCATCCGCTTGGGGGACAG
  • Show more
Description: A cloning plasmid for the NRN1L gene.

NRN1L Polyclonal Antibody

A64986 100 µg
EUR 570.55
Description: fast delivery possible

NRN1L Rabbit pAb

A16594-100ul 100 ul
EUR 308

NRN1L Rabbit pAb

A16594-200ul 200 ul
EUR 459

NRN1L Rabbit pAb

A16594-20ul 20 ul
EUR 183

NRN1L Rabbit pAb

A16594-50ul 50 ul
EUR 223

Anti-NRN1L antibody

STJ119033 100 µl
EUR 277

NRN1L Antibody, HRP conjugated

1-CSB-PA670967LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1L. Recognizes NRN1L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRN1L Antibody, FITC conjugated

1-CSB-PA670967LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1L. Recognizes NRN1L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRN1L Antibody, Biotin conjugated

1-CSB-PA670967LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1L. Recognizes NRN1L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NRN1L ELISA KIT|Human

EF005334 96 Tests
EUR 689

Human NRN1L shRNA Plasmid

20-abx964745
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NRN1L Polyclonal Conjugated Antibody

C29898 100ul
EUR 397

Mouse NRN1L shRNA Plasmid

20-abx982150
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NRN1L Recombinant Protein (Human)

RP041755 100 ug Ask for price

NRN1L Recombinant Protein (Mouse)

RP155054 100 ug Ask for price

NRN1L Recombinant Protein (Rat)

RP214562 100 ug Ask for price

Neuritin-Like Protein (NRN1L) Antibody

abx027102-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody

abx027102-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody

20-abx301402
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NRN1L Polyclonal Antibody, HRP Conjugated

A64987 100 µg
EUR 570.55
Description: reagents widely cited

NRN1L Polyclonal Antibody, FITC Conjugated

A64988 100 µg
EUR 570.55
Description: Ask the seller for details

NRN1L Polyclonal Antibody, Biotin Conjugated

A64989 100 µg
EUR 570.55
Description: The best epigenetics products

Nrn1l ORF Vector (Rat) (pORF)

ORF071522 1.0 ug DNA
EUR 506

NRN1L ORF Vector (Human) (pORF)

ORF013919 1.0 ug DNA
EUR 354

Nrn1l ORF Vector (Mouse) (pORF)

ORF051686 1.0 ug DNA
EUR 506

Neuritin-Like Protein (NRN1L) Antibody (HRP)

20-abx307272
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody (FITC)

20-abx307273
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody (Biotin)

20-abx307274
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nrn1l sgRNA CRISPR Lentivector set (Rat)

K6055201 3 x 1.0 ug
EUR 339

Nrn1l sgRNA CRISPR Lentivector set (Mouse)

K3136801 3 x 1.0 ug
EUR 339

NRN1L sgRNA CRISPR Lentivector set (Human)

K1456001 3 x 1.0 ug
EUR 339

Mouse Neuritin- like protein, Nrn1l ELISA KIT

ELI-22406m 96 Tests
EUR 865

Human Neuritin-like protein (NRN1L) ELISA Kit

abx385206-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuritin-like protein (NRN1L) ELISA Kit

abx390008-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nrn1l sgRNA CRISPR Lentivector (Rat) (Target 1)

K6055202 1.0 ug DNA
EUR 154

Nrn1l sgRNA CRISPR Lentivector (Rat) (Target 2)

K6055203 1.0 ug DNA
EUR 154

Nrn1l sgRNA CRISPR Lentivector (Rat) (Target 3)

K6055204 1.0 ug DNA
EUR 154

Human Neuritin- like protein, NRN1L ELISA KIT

ELI-36828h 96 Tests
EUR 824

Nrn1l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3136802 1.0 ug DNA
EUR 154

Nrn1l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3136803 1.0 ug DNA
EUR 154

Nrn1l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3136804 1.0 ug DNA
EUR 154

NRN1L sgRNA CRISPR Lentivector (Human) (Target 1)

K1456002 1.0 ug DNA
EUR 154

NRN1L sgRNA CRISPR Lentivector (Human) (Target 2)

K1456003 1.0 ug DNA
EUR 154

NRN1L sgRNA CRISPR Lentivector (Human) (Target 3)

K1456004 1.0 ug DNA
EUR 154

NRN1L Protein Vector (Rat) (pPB-C-His)

PV286086 500 ng
EUR 603

NRN1L Protein Vector (Rat) (pPB-N-His)

PV286087 500 ng
EUR 603

NRN1L Protein Vector (Rat) (pPM-C-HA)

PV286088 500 ng
EUR 603

NRN1L Protein Vector (Rat) (pPM-C-His)

PV286089 500 ng
EUR 603

NRN1L Protein Vector (Mouse) (pPB-C-His)

PV206742 500 ng
EUR 603

NRN1L Protein Vector (Mouse) (pPB-N-His)

PV206743 500 ng
EUR 603

NRN1L Protein Vector (Mouse) (pPM-C-HA)

PV206744 500 ng
EUR 603

NRN1L Protein Vector (Mouse) (pPM-C-His)

PV206745 500 ng
EUR 603

NRN1L Protein Vector (Human) (pPB-C-His)

PV055673 500 ng
EUR 481

NRN1L Protein Vector (Human) (pPB-N-His)

PV055674 500 ng
EUR 481

NRN1L Protein Vector (Human) (pPM-C-HA)

PV055675 500 ng
EUR 481

NRN1L Protein Vector (Human) (pPM-C-His)

PV055676 500 ng
EUR 481

Nrn1l 3'UTR Luciferase Stable Cell Line

TU114331 1.0 ml Ask for price

Nrn1l 3'UTR GFP Stable Cell Line

TU164331 1.0 ml Ask for price

Nrn1l 3'UTR Luciferase Stable Cell Line

TU214199 1.0 ml Ask for price

Nrn1l 3'UTR GFP Stable Cell Line

TU264199 1.0 ml Ask for price

NRN1L 3'UTR GFP Stable Cell Line

TU065980 1.0 ml
EUR 1394

NRN1L 3'UTR Luciferase Stable Cell Line

TU015980 1.0 ml
EUR 1394

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651079 1.0 ug DNA
EUR 514

NRN1L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651083 1.0 ug DNA
EUR 514

NRN1L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651084 1.0 ug DNA
EUR 514

Nrn1l ELISA Kit| Mouse Neuritin-like protein ELISA Kit

EF015647 96 Tests
EUR 689

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6055205 3 x 1.0 ug
EUR 376

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3136805 3 x 1.0 ug
EUR 376

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1456005 3 x 1.0 ug
EUR 376

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6055206 1.0 ug DNA
EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6055207 1.0 ug DNA
EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6055208 1.0 ug DNA
EUR 167

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV651080 1.0 ug DNA
EUR 514

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV651081 1.0 ug DNA
EUR 572

NRN1L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV651082 1.0 ug DNA
EUR 572

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3136806 1.0 ug DNA
EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3136807 1.0 ug DNA
EUR 167

Nrn1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3136808 1.0 ug DNA
EUR 167

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1456006 1.0 ug DNA
EUR 167

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1456007 1.0 ug DNA
EUR 167

NRN1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1456008 1.0 ug DNA
EUR 167