

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BATF Antibody

AF0722 200ul
EUR 304
Description: BATF Antibody detects endogenous levels of BATF.

BATF Antibody

ABF0722 100 ug
EUR 438

BATF antibody

70R-31925 100 ug
EUR 327
Description: Rabbit polyclonal BATF antibody

BATF Antibody

33911-100ul 100ul
EUR 252

BATF Antibody

33911-50ul 50ul
EUR 187

BATF Antibody

46333-100ul 100ul
EUR 252

BATF antibody

70R-15963 50 ul
EUR 435
Description: Rabbit polyclonal BATF antibody

BATF Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

BATF Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BATF Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BATF Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

BATF Antibody

CSB-PA109532-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against BATF. Recognizes BATF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100


YF-PA17035 50 ug
EUR 363
Description: Mouse polyclonal to BATF


YF-PA17036 100 ug
EUR 403
Description: Rabbit polyclonal to BATF


YF-PA25608 50 ul
EUR 334
Description: Mouse polyclonal to BATF

BATF Conjugated Antibody

C33911 100ul
EUR 397

BATF Blocking Peptide

AF0722-BP 1mg
EUR 195

anti- BATF antibody

FNab00807 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:10-1:100
  • Immunogen: basic leucine zipper transcription factor, ATF-like
  • Uniprot ID: Q16520
  • Gene ID: 10538
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against BATF

BATF Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

BATF Polyclonal Antibody

A58242 100 µg
EUR 570.55
Description: Ask the seller for details

BATF Rabbit pAb

A14667-100ul 100 ul
EUR 308

BATF Rabbit pAb

A14667-200ul 200 ul
EUR 459

BATF Rabbit pAb

A14667-20ul 20 ul
EUR 183

BATF Rabbit pAb

A14667-50ul 50 ul
EUR 223

BATF Rabbit pAb

A8907-100ul 100 ul
EUR 308

BATF Rabbit pAb

A8907-200ul 200 ul
EUR 459

BATF Rabbit pAb

A8907-20ul 20 ul Ask for price

BATF Rabbit pAb

A8907-50ul 50 ul Ask for price

Human BATF Antibody

32089-05111 150 ug
EUR 261

BATF cloning plasmid

CSB-CL619074HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atgcctcacagctccgacagcagtgactccagcttcagccgctctcctccccctggcaaacaggactcatctgatgatgtgagaagagttcagaggagggagaaaaatcgtattgccgcccagaagagccgacagaggcagacacagaaggccgacaccctgcacctggagagcga
  • Show more
Description: A cloning plasmid for the BATF gene.

Anti-BATF antibody

PAab00807 100 ug
EUR 355

Anti-BATF antibody

STJ72996 100 µg
EUR 260

Anti-BATF antibody

STJ111472 100 µl
EUR 277
Description: The protein encoded by this gene is a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. The leucine zipper of this protein mediates dimerization with members of the Jun family of proteins. This protein is thought to be a negative regulator of AP-1/ATF transcriptional events.

Anti-BATF antibody

STJ116871 100 µl
EUR 277
Description: The protein encoded by this gene is a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. The leucine zipper of this protein mediates dimerization with members of the Jun family of proteins. This protein is thought to be a negative regulator of AP-1/ATF transcriptional events.

Anti-BATF (1G4)

YF-MA17359 100 ug
EUR 363
Description: Mouse monoclonal to BATF

Anti-BATF (8A12)

YF-MA11295 100 ug
EUR 363
Description: Mouse monoclonal to BATF

Mouse BATF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat BATF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHB0645 96Tests
EUR 521


EGTB0645 96Tests
EUR 521


ECB0645 96Tests
EUR 521


EBB0645 96Tests
EUR 521

Anserini BATF ELISA Kit

EAB0645 96Tests
EUR 521


EF008067 96 Tests
EUR 689


ERB0645 96Tests
EUR 521


ERTB0645 96Tests
EUR 521

Mouse Batf ELISA KIT

ELI-48903m 96 Tests
EUR 865


ELI-49946h 96 Tests
EUR 824