RPL5 siRNA
20-abx904673	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL5 antibody
70R-4629	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RPL5 antibody raised against the N terminal of RPL5

RPL5 antibody
70R-33963	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL5 antibody

RPL5 Antibody
ABD3712	Lifescience Market	100 ug	EUR 438

RPL5 Antibody
ABD6730	Lifescience Market	100 ug	EUR 438

RPL5 Antibody
34363-100ul	SAB	100ul	EUR 252

RPL5 Antibody
34363-50ul	SAB	50ul	EUR 187

RPL5 Antibody
32531-100ul	SAB	100ul	EUR 252

RPL5 antibody
70R-19985	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL5 antibody

RPL5 antibody
70R-15211	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL5 antibody

RPL5 Antibody
DF6730	Affbiotech	200ul	EUR 304
Description: RPL5 Antibody detects endogenous levels of total RPL5.

RPL5 siRNA
20-abx931987	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL5 siRNA
20-abx931988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL5 Antibody
DF3712	Affbiotech	200ul	EUR 304
Description: RPL5 Antibody detects endogenous levels of total RPL5.

RPL5 Antibody
CSB-PA276101-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL5 Antibody
CSB-PA276101-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL5 Antibody
1-CSB-PA040235	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

RPL5 Antibody
1-CSB-PA020297GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL5 Antibody
1-CSB-PA02495A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal RPL5 Antibody
APR05621G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL5 . This antibody is tested and proven to work in the following applications:

RPL5 Conjugated Antibody
C34363	SAB	100ul	EUR 397

RPL5 cloning plasmid
CSB-CL020297HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 306 Sequence: atggggtttgttaaagttgttaagaataaggcctactttaagagataccaagtgaaatttagaagacgacgagagggtaaaactgattattatgctcggaaacgcttggtgatacaagataaaaataaatacaacacacccaaatacaggatgatagttcgtgtgacaaacagaga Show more
Description: A cloning plasmid for the RPL5 gene.

anti- RPL5 antibody
FNab07440	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: ribosomal protein L5 Uniprot ID: P46777 Gene ID: 6125 Research Area: Epigenetics, Metabolism
Description: Antibody raised against RPL5

RPL5 Polyclonal Antibody
A51577	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RPL5 Rabbit pAb
A1977-100ul	Abclonal	100 ul	EUR 308

RPL5 Rabbit pAb
A1977-200ul	Abclonal	200 ul	EUR 459

RPL5 Rabbit pAb
A1977-20ul	Abclonal	20 ul	EUR 183

RPL5 Rabbit pAb
A1977-50ul	Abclonal	50 ul	EUR 223

RPL5 Blocking Peptide
33R-8055	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL5 antibody, catalog no. 70R-4629

RPL5 antibody (HRP)
60R-1474	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL5 antibody (HRP)

RPL5 antibody (FITC)
60R-1475	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL5 antibody (FITC)

RPL5 antibody (biotin)
60R-1476	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL5 antibody (biotin)

RPL5 Blocking Peptide
DF6730-BP	Affbiotech	1mg	EUR 195

RPL5 Blocking Peptide
DF3712-BP	Affbiotech	1mg	EUR 195

Anti-RPL5 antibody
PAab07440	Lifescience Market	100 ug	EUR 386

Anti-RPL5 antibody
STJ25399	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Rat RPL5 shRNA Plasmid
20-abx986697	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RPL5 shRNA Plasmid
20-abx984337	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL5 ELISA KIT|Human
EF002598	Lifescience Market	96 Tests	EUR 689

Human RPL5 shRNA Plasmid
20-abx954119	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL5 protein (His tag)
80R-3914	Fitzgerald	50 ug	EUR 435
Description: Purified recombinant RPL5 protein (His tag)

RPL5 Antibody, HRP conjugated
1-CSB-PA02495B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL5 Antibody, FITC conjugated
1-CSB-PA02495C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL5 Antibody, Biotin conjugated
1-CSB-PA02495D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL5 Recombinant Protein (Human)
RP027007	ABM	100 ug	Ask for price

RPL5 Recombinant Protein (Rat)
RP226715	ABM	100 ug	Ask for price

RPL5 Recombinant Protein (Mouse)
RP169109	ABM	100 ug	Ask for price

Ribosomal Protein L5 (RPL5) Antibody
20-abx115245	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody
20-abx001611	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody
20-abx133501	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody
20-abx328670	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody
abx332721-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody
abx237440-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein L5 (RPL5) Protein
20-abx262810	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

RPL5 Polyclonal Antibody, HRP Conjugated
A51578	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RPL5 Polyclonal Antibody, FITC Conjugated
A51579	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RPL5 Polyclonal Antibody, Biotin Conjugated
A51580	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPL5 ORF Vector (Human) (pORF)
ORF009003	ABM	1.0 ug DNA	EUR 95

Rpl5 ORF Vector (Mouse) (pORF)
ORF056371	ABM	1.0 ug DNA	EUR 506

Rpl5 ORF Vector (Rat) (pORF)
ORF075573	ABM	1.0 ug DNA	EUR 506

Polyclonal Rpl5 antibody - C-terminal region
APR01312G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rpl5 - C-terminal region. This antibody is tested and proven to work in the following applications:

Ribosomal Protein L5 (RPL5) Antibody Pair
abx117391-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

60S Ribosomal Protein L5 (RPL5) Antibody
20-abx109476	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Blocking Peptide
20-abx061083	Abbexa	EUR 286.00 EUR 425.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-RPL5/Ribosomal Protein L5 Antibody
A02843	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RPL5/Ribosomal Protein L5 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RPL5 sgRNA CRISPR Lentivector set (Human)
K1874901	ABM	3 x 1.0 ug	EUR 339

Human 60S ribosomal protein L5 (RPL5)
1-CSB-RP024954h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 61.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L5(RPL5) expressed in E.coli

Rpl5 sgRNA CRISPR Lentivector set (Mouse)
K4916701	ABM	3 x 1.0 ug	EUR 339

Rpl5 sgRNA CRISPR Lentivector set (Rat)
K7017801	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein L5 (RPL5) ELISA Kit
abx382924-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

RPL5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1874902	ABM	1.0 ug DNA	EUR 154

RPL5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1874903	ABM	1.0 ug DNA	EUR 154

RPL5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1874904	ABM	1.0 ug DNA	EUR 154

Rpl5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4916702	ABM	1.0 ug DNA	EUR 154

Rpl5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4916703	ABM	1.0 ug DNA	EUR 154

Rpl5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4916704	ABM	1.0 ug DNA	EUR 154

Rpl5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7017802	ABM	1.0 ug DNA	EUR 154

Rpl5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7017803	ABM	1.0 ug DNA	EUR 154

Rpl5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7017804	ABM	1.0 ug DNA	EUR 154

RPL5 Protein Vector (Human) (pPB-C-His)
PV036009	ABM	500 ng	EUR 329

RPL5 Protein Vector (Human) (pPB-N-His)
PV036010	ABM	500 ng	EUR 329

RPL5 Protein Vector (Human) (pPM-C-HA)
PV036011	ABM	500 ng	EUR 329

RPL5 Protein Vector (Human) (pPM-C-His)
PV036012	ABM	500 ng	EUR 329

RPL5 Ribosomal Protein L5 Human Recombinant Protein
PROTP46777	BosterBio	Regular: 10ug	EUR 317
Description: RPL5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 320 amino acids (1-297 a.a.) and having a molecular mass of 36.8kDa.;RPL5 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL5 Protein Vector (Rat) (pPB-C-His)
PV302290	ABM	500 ng	EUR 603