RPL5

RPL5 siRNA

20-abx904673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL5 antibody

70R-4629 50 ug
EUR 467
Description: Rabbit polyclonal RPL5 antibody raised against the N terminal of RPL5

RPL5 antibody

70R-33963 100 ug
EUR 327
Description: Rabbit polyclonal RPL5 antibody

RPL5 Antibody

ABD3712 100 ug
EUR 438

RPL5 Antibody

ABD6730 100 ug
EUR 438

RPL5 Antibody

34363-100ul 100ul
EUR 252

RPL5 Antibody

34363-50ul 50ul
EUR 187

RPL5 Antibody

32531-100ul 100ul
EUR 252

RPL5 antibody

70R-19985 50 ul
EUR 435
Description: Rabbit polyclonal RPL5 antibody

RPL5 antibody

70R-15211 100 ug
EUR 327
Description: Rabbit polyclonal RPL5 antibody

RPL5 Antibody

DF6730 200ul
EUR 304
Description: RPL5 Antibody detects endogenous levels of total RPL5.

RPL5 siRNA

20-abx931987
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL5 siRNA

20-abx931988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL5 Antibody

DF3712 200ul
EUR 304
Description: RPL5 Antibody detects endogenous levels of total RPL5.

RPL5 Antibody

CSB-PA276101-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL5 Antibody

CSB-PA276101-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL5 Antibody

1-CSB-PA040235
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

RPL5 Antibody

1-CSB-PA020297GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL5 Antibody

1-CSB-PA02495A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal RPL5 Antibody

APR05621G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL5 . This antibody is tested and proven to work in the following applications:

RPL5 Conjugated Antibody

C34363 100ul
EUR 397

RPL5 cloning plasmid

CSB-CL020297HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atggggtttgttaaagttgttaagaataaggcctactttaagagataccaagtgaaatttagaagacgacgagagggtaaaactgattattatgctcggaaacgcttggtgatacaagataaaaataaatacaacacacccaaatacaggatgatagttcgtgtgacaaacagaga
  • Show more
Description: A cloning plasmid for the RPL5 gene.

anti- RPL5 antibody

FNab07440 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ribosomal protein L5
  • Uniprot ID: P46777
  • Gene ID: 6125
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against RPL5

RPL5 Polyclonal Antibody

A51577 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL5 Rabbit pAb

A1977-100ul 100 ul
EUR 308

RPL5 Rabbit pAb

A1977-200ul 200 ul
EUR 459

RPL5 Rabbit pAb

A1977-20ul 20 ul
EUR 183

RPL5 Rabbit pAb

A1977-50ul 50 ul
EUR 223

RPL5 Blocking Peptide

33R-8055 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL5 antibody, catalog no. 70R-4629

RPL5 antibody (HRP)

60R-1474 100 ug
EUR 327
Description: Rabbit polyclonal RPL5 antibody (HRP)

RPL5 antibody (FITC)

60R-1475 100 ug
EUR 327
Description: Rabbit polyclonal RPL5 antibody (FITC)

RPL5 antibody (biotin)

60R-1476 100 ug
EUR 327
Description: Rabbit polyclonal RPL5 antibody (biotin)

RPL5 Blocking Peptide

DF6730-BP 1mg
EUR 195

RPL5 Blocking Peptide

DF3712-BP 1mg
EUR 195

Anti-RPL5 antibody

PAab07440 100 ug
EUR 386

Anti-RPL5 antibody

STJ25399 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Rat RPL5 shRNA Plasmid

20-abx986697
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL5 shRNA Plasmid

20-abx984337
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL5 ELISA KIT|Human

EF002598 96 Tests
EUR 689

Human RPL5 shRNA Plasmid

20-abx954119
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL5 protein (His tag)

80R-3914 50 ug
EUR 435
Description: Purified recombinant RPL5 protein (His tag)

RPL5 Antibody, HRP conjugated

1-CSB-PA02495B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL5 Antibody, FITC conjugated

1-CSB-PA02495C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL5 Antibody, Biotin conjugated

1-CSB-PA02495D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL5. Recognizes RPL5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL5 Recombinant Protein (Human)

RP027007 100 ug Ask for price

RPL5 Recombinant Protein (Rat)

RP226715 100 ug Ask for price

RPL5 Recombinant Protein (Mouse)

RP169109 100 ug Ask for price

Ribosomal Protein L5 (RPL5) Antibody

20-abx115245
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody

20-abx001611
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody

20-abx133501
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody

20-abx328670
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody

abx332721-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Antibody

abx237440-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L5 (RPL5) Protein

20-abx262810
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RPL5 Polyclonal Antibody, HRP Conjugated

A51578 100 µg
EUR 570.55
Description: fast delivery possible

RPL5 Polyclonal Antibody, FITC Conjugated

A51579 100 µg
EUR 570.55
Description: reagents widely cited

RPL5 Polyclonal Antibody, Biotin Conjugated

A51580 100 µg
EUR 570.55
Description: Ask the seller for details

RPL5 ORF Vector (Human) (pORF)

ORF009003 1.0 ug DNA
EUR 95

Rpl5 ORF Vector (Mouse) (pORF)

ORF056371 1.0 ug DNA
EUR 506

Rpl5 ORF Vector (Rat) (pORF)

ORF075573 1.0 ug DNA
EUR 506

Polyclonal Rpl5 antibody - C-terminal region

APR01312G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rpl5 - C-terminal region. This antibody is tested and proven to work in the following applications:

Ribosomal Protein L5 (RPL5) Antibody Pair

abx117391-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

60S Ribosomal Protein L5 (RPL5) Antibody

20-abx109476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L5 (RPL5) Blocking Peptide

20-abx061083
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-RPL5/Ribosomal Protein L5 Antibody

A02843 100ul
EUR 397
Description: Rabbit Polyclonal RPL5/Ribosomal Protein L5 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RPL5 sgRNA CRISPR Lentivector set (Human)

K1874901 3 x 1.0 ug
EUR 339

Human 60S ribosomal protein L5 (RPL5)

1-CSB-RP024954h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 61.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L5(RPL5) expressed in E.coli

Rpl5 sgRNA CRISPR Lentivector set (Mouse)

K4916701 3 x 1.0 ug
EUR 339

Rpl5 sgRNA CRISPR Lentivector set (Rat)

K7017801 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L5 (RPL5) ELISA Kit

abx382924-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPL5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1874902 1.0 ug DNA
EUR 154

RPL5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1874903 1.0 ug DNA
EUR 154

RPL5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1874904 1.0 ug DNA
EUR 154

Rpl5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4916702 1.0 ug DNA
EUR 154

Rpl5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4916703 1.0 ug DNA
EUR 154

Rpl5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4916704 1.0 ug DNA
EUR 154

Rpl5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7017802 1.0 ug DNA
EUR 154

Rpl5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7017803 1.0 ug DNA
EUR 154

Rpl5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7017804 1.0 ug DNA
EUR 154

RPL5 Protein Vector (Human) (pPB-C-His)

PV036009 500 ng
EUR 329

RPL5 Protein Vector (Human) (pPB-N-His)

PV036010 500 ng
EUR 329

RPL5 Protein Vector (Human) (pPM-C-HA)

PV036011 500 ng
EUR 329

RPL5 Protein Vector (Human) (pPM-C-His)

PV036012 500 ng
EUR 329

RPL5 Ribosomal Protein L5 Human Recombinant Protein

PROTP46777 Regular: 10ug
EUR 317
Description: RPL5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 320 amino acids (1-297 a.a.) and having a molecular mass of 36.8kDa.;RPL5 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL5 Protein Vector (Rat) (pPB-C-His)

PV302290 500 ng
EUR 603