COG3 antibody

70R-16492 50 ul
EUR 435
Description: Rabbit polyclonal COG3 antibody

COG3 Antibody

DF12905 200ul
EUR 304
Description: COG3 Antibody detects endogenous levels of COG3.

COG3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COG3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


YF-PA21221 50 ul
EUR 363
Description: Mouse polyclonal to COG3


YF-PA27635 50 ug
EUR 363
Description: Mouse polyclonal to COG3

anti- COG3 antibody

FNab01829 100µg
EUR 505.25
  • Immunogen: component of oligomeric golgi complex 3
  • Uniprot ID: Q96JB2
  • Gene ID: 83548
  • Research Area: Signal Transduction
Description: Antibody raised against COG3

COG3 Rabbit pAb

A17785-100ul 100 ul
EUR 308

COG3 Rabbit pAb

A17785-200ul 200 ul
EUR 459

COG3 Rabbit pAb

A17785-20ul 20 ul
EUR 183

COG3 Rabbit pAb

A17785-50ul 50 ul
EUR 223

COG3 Polyclonal Antibody

A66598 100 µg
EUR 570.55
Description: reagents widely cited

COG3 Polyclonal Antibody

30178-100ul 100ul
EUR 252

COG3 Polyclonal Antibody

30178-50ul 50ul
EUR 187

COG3 Blocking Peptide

DF12905-BP 1mg
EUR 195

COG3 cloning plasmid

CSB-CL839348HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atggcggaggcggcgctgttgctgctgcctgaggcggcggcggagcgggacgctagggaaaagctggctctctgggatcggagaccggacacgacggcgccgctgaccgacaggcagacggactcggtattggagctgaaggcggcggcagagaacttgccggtgccagctgagc
  • Show more
Description: A cloning plasmid for the COG3 gene.

Anti-COG3 antibody

PAab01829 100 ug
EUR 355

Anti-COG3 antibody

STJ119817 100 µl
EUR 277
Description: This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]

Anti-COG3 (2G7)

YF-MA19468 100 ug
EUR 363
Description: Mouse monoclonal to COG3

COG3 Polyclonal Conjugated Antibody

C30178 100ul
EUR 397

Human COG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF008776 96 Tests
EUR 689

COG3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COG3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COG3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COG3 Recombinant Protein (Human)

RP007579 100 ug Ask for price

COG3 Recombinant Protein (Rat)

RP195749 100 ug Ask for price

COG3 Recombinant Protein (Mouse)

RP125231 100 ug Ask for price

COG3 Polyclonal Antibody, HRP Conjugated

A66599 100 µg
EUR 570.55
Description: Ask the seller for details

COG3 Polyclonal Antibody, FITC Conjugated

A66600 100 µg
EUR 570.55
Description: The best epigenetics products

COG3 Polyclonal Antibody, Biotin Conjugated

A66601 100 µg
EUR 570.55
Description: kits suitable for this type of research

COG3 ORF Vector (Human) (pORF)

ORF002527 1.0 ug DNA
EUR 95

Cog3 ORF Vector (Rat) (pORF)

ORF065251 1.0 ug DNA
EUR 506

Cog3 ORF Vector (Mouse) (pORF)

ORF041745 1.0 ug DNA
EUR 506

COG3 sgRNA CRISPR Lentivector set (Human)

K0481001 3 x 1.0 ug
EUR 339

Cog3 sgRNA CRISPR Lentivector set (Mouse)

K3568401 3 x 1.0 ug
EUR 339

Cog3 sgRNA CRISPR Lentivector set (Rat)

K6148301 3 x 1.0 ug
EUR 339

COG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0481002 1.0 ug DNA
EUR 154

COG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0481003 1.0 ug DNA
EUR 154

COG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0481004 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3568402 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3568403 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3568404 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6148302 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6148303 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6148304 1.0 ug DNA
EUR 154

COG3 Protein Vector (Mouse) (pPB-C-His)

PV166978 500 ng
EUR 1065

COG3 Protein Vector (Mouse) (pPB-N-His)

PV166979 500 ng
EUR 1065

COG3 Protein Vector (Mouse) (pPM-C-HA)

PV166980 500 ng
EUR 1065

COG3 Protein Vector (Mouse) (pPM-C-His)

PV166981 500 ng
EUR 1065

COG3 Protein Vector (Human) (pPB-C-His)

PV010105 500 ng
EUR 329

COG3 Protein Vector (Human) (pPB-N-His)

PV010106 500 ng
EUR 329

COG3 Protein Vector (Human) (pPM-C-HA)

PV010107 500 ng
EUR 329

COG3 Protein Vector (Human) (pPM-C-His)

PV010108 500 ng
EUR 329

COG3 Protein Vector (Rat) (pPB-C-His)

PV261002 500 ng
EUR 1166

COG3 Protein Vector (Rat) (pPB-N-His)

PV261003 500 ng
EUR 1166

COG3 Protein Vector (Rat) (pPM-C-HA)

PV261004 500 ng
EUR 1166

COG3 Protein Vector (Rat) (pPM-C-His)

PV261005 500 ng
EUR 1166

Cog3 3'UTR Luciferase Stable Cell Line

TU202595 1.0 ml Ask for price

Cog3 3'UTR GFP Stable Cell Line

TU154152 1.0 ml Ask for price

COG3 3'UTR Luciferase Stable Cell Line

TU004744 1.0 ml
EUR 1521

Cog3 3'UTR Luciferase Stable Cell Line

TU104152 1.0 ml Ask for price

COG3 3'UTR GFP Stable Cell Line

TU054744 1.0 ml
EUR 1521

Cog3 3'UTR GFP Stable Cell Line

TU252595 1.0 ml Ask for price

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

abx026276-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

abx026276-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

abx231829-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.