CBX5 Antibody

31049-50ul 50ul
EUR 187

CBX5 antibody

70R-16201 50 ul
EUR 435
Description: Rabbit polyclonal CBX5 antibody

CBX5 antibody

70R-31722 100 ug
EUR 327
Description: Rabbit polyclonal CBX5 antibody

CBX5 Antibody

33774-100ul 100ul
EUR 252

CBX5 Antibody

33774-50ul 50ul
EUR 187

CBX5 Antibody

32158-100ul 100ul
EUR 252

CBX5 Antibody

EUR 414

CBX5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CBX5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CBX5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

CBX5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

CBX5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

CBX5 Antibody

DF6241 200ul
EUR 304
Description: CBX5 Antibody detects endogenous levels of total CBX5.

CBX5 Antibody

BF0724 200ul
EUR 376
Description: HP1 alpha Monoclonal Antibody detects endogenous levels of total HP1 alpha.

CBX5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CBX5 Antibody

ABD6241 100 ug
EUR 438


YF-PA27518 50 ul
EUR 363
Description: Mouse polyclonal to CBX5

CBX5 Monoclonal Antibody

27012-100ul 100ul
EUR 252

CBX5 Monoclonal Antibody

27012-50ul 50ul
EUR 187

CBX5 Mouse mAb

A10612-100ul 100 ul
EUR 384

CBX5 Mouse mAb

A10612-200ul 200 ul
EUR 554

CBX5 Mouse mAb

A10612-20ul 20 ul Ask for price

CBX5 Mouse mAb

A10612-50ul 50 ul
EUR 265

CBX5 Rabbit pAb

A1098-100ul 100 ul
EUR 308

CBX5 Rabbit pAb

A1098-200ul 200 ul
EUR 459

CBX5 Rabbit pAb

A1098-20ul 20 ul
EUR 183

CBX5 Rabbit pAb

A1098-50ul 50 ul
EUR 223

CBX5 Rabbit pAb

A12577-100ul 100 ul
EUR 308

CBX5 Rabbit pAb

A12577-200ul 200 ul
EUR 459

CBX5 Rabbit pAb

A12577-20ul 20 ul
EUR 183

CBX5 Rabbit pAb

A12577-50ul 50 ul
EUR 223

CBX5 Rabbit pAb

A12592-100ul 100 ul
EUR 308

CBX5 Rabbit pAb

A12592-200ul 200 ul
EUR 459

CBX5 Rabbit pAb

A12592-20ul 20 ul
EUR 183

CBX5 Rabbit pAb

A12592-50ul 50 ul
EUR 223

CBX5 Blocking Peptide

DF6241-BP 1mg
EUR 195

CBX5 Rabbit pAb

A0132-100ul 100 ul
EUR 308

CBX5 Rabbit pAb

A0132-200ul 200 ul
EUR 459

CBX5 Rabbit pAb

A0132-20ul 20 ul Ask for price

CBX5 Rabbit pAb

A0132-50ul 50 ul Ask for price

CBX5 Polyclonal Antibody

A-2701 100 µl
EUR 483.55
Description: kits suitable for this type of research

CBX5 Conjugated Antibody

C32158 100ul
EUR 397

CBX5 Conjugated Antibody

C31049 100ul
EUR 397

CBX5 Blocking Peptide

BF0724-BP 1mg
EUR 195

CBX5 (pS92) Antibody

abx332857-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

CBX5 cloning plasmid

CSB-CL004601HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atgggaaagaaaaccaagcggacagctgacagttcttcttcagaggatgaggaggagtatgttgtggagaaggtgctagacaggcgcgtggttaagggacaagtggaatatctactgaagtggaaaggcttttctgaggagcacaatacttgggaacctgagaaaaacttggattg
  • Show more
Description: A cloning plasmid for the CBX5 gene.

CBX5 Polyclonal Antibody

A50101 100 µg
EUR 570.55
Description: Ask the seller for details

anti- CBX5 antibody

FNab01332 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: chromobox homolog 5 (HP1 alpha homolog, Drosophila)
  • Uniprot ID: P45973
  • Gene ID: 23468
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against CBX5

Anti-CBX5 antibody

PAab01332 100 ug
EUR 355


PVT12566 2 ug
EUR 391

Anti-CBX5 antibody

STJ110917 100 µl
EUR 277
Description: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-CBX5 antibody

STJ112622 100 µl
EUR 393
Description: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-CBX5 antibody

STJ114451 100 µl
EUR 277
Description: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-CBX5 antibody

STJ114466 100 µl
EUR 277
Description: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-CBX5 antibody

STJ22922 100 µl
EUR 277
Description: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified.

CBX5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CBX5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CBX5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX5. Recognizes CBX5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CBX5 (Ab-92) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CBX5 (Ab-92). Recognizes CBX5 (Ab-92) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CBX5 (Ab-92) Antibody

CSB-PA971900-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CBX5 (Ab-92). Recognizes CBX5 (Ab-92) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-CBX5 (Ser92) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CBX5 (Ser92). Recognizes Phospho-CBX5 (Ser92) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

Phospho-CBX5 (Ser92) Antibody

CSB-PA796826-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CBX5 (Ser92). Recognizes Phospho-CBX5 (Ser92) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

CBX5 protein (His tag)

80R-2204 100 ug
EUR 322
Description: Purified recombinant Human CBX5 Protein (His tag)

Chromobox 5 (CBX5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox 5 (CBX5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox 5 (CBX5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.


EF008424 96 Tests
EUR 689

CBX5 Conjugated Monoclonal Antibody

C27012 100ul
EUR 397

Phospho-CBX5 (S92) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CBX5 (S92). Recognizes Phospho-CBX5 (S92) from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

Chromobox 5 (CBX5) Antibody

abx330562-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Chromobox 5 (CBX5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromobox 5 (CBX5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.


abx595755-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human CBX5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CBX5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CBX5 Recombinant Protein (Human)

RP005758 100 ug Ask for price

CBX5 Recombinant Protein (Rat)

RP193325 100 ug Ask for price

CBX5 Recombinant Protein (Mouse)

RP121454 100 ug Ask for price

CBX5 Recombinant Protein (Mouse)

RP121457 100 ug Ask for price

CBX5 Recombinant Protein (Mouse)

RP121460 100 ug Ask for price

Chromobox Homolog 5 (CBX5) Antibody

abx027602-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (CBX5) Antibody

abx027602-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (CBX5) Antibody

abx224232-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (CBX5) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (CBX5) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (CBX5) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (CBX5) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Chromobox Homolog 5 (Cbx5) Antibody

abx030865-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.