GNAI2

Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) ELISA Kit

DLR-GNAI2-Hu-96T 96T
EUR 673
  • Should the Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) ELISA Kit

RDR-GNAI2-Hu-48Tests 48 Tests
EUR 544

Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) ELISA Kit

RDR-GNAI2-Hu-96Tests 96 Tests
EUR 756

Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) ELISA Kit

RD-GNAI2-Hu-48Tests 48 Tests
EUR 521

Human Guanine Nucleotide-Binding Protein G(i) Subunit Alpha-2 (GNAI2) ELISA Kit

RD-GNAI2-Hu-96Tests 96 Tests
EUR 723

Gnai2/ Rat Gnai2 ELISA Kit

ELI-08737r 96 Tests
EUR 886

GNAI2 antibody

70R-17520 50 ul
EUR 435
Description: Rabbit polyclonal GNAI2 antibody

GNAI2 Antibody

43476-100ul 100ul
EUR 252

GNAI2 Antibody

43671-100ul 100ul
EUR 252

GNAI2 Antibody

DF13045 200ul
EUR 304
Description: GNAI2 Antibody detects endogenous levels of GNAI2.

GNAI2 antibody

70R-5712 50 ug
EUR 467
Description: Rabbit polyclonal GNAI2 antibody

GNAI2 antibody

70R-5719 50 ug
EUR 467
Description: Rabbit polyclonal GNAI2 antibody

GNAI2 Protein

20-abx261928
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GNAI2 Antibody

1-CSB-PA009589GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAI2. Recognizes GNAI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNAI2 siRNA

20-abx902213
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI2 siRNA

20-abx918144
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI2 siRNA

20-abx918145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI2 Rabbit pAb

A14204-100ul 100 ul
EUR 308

GNAI2 Rabbit pAb

A14204-200ul 200 ul
EUR 459

GNAI2 Rabbit pAb

A14204-20ul 20 ul
EUR 183

GNAI2 Rabbit pAb

A14204-50ul 50 ul
EUR 223

GNAI2 Rabbit pAb

A14547-100ul 100 ul
EUR 308

GNAI2 Rabbit pAb

A14547-200ul 200 ul
EUR 459

GNAI2 Rabbit pAb

A14547-20ul 20 ul
EUR 183

GNAI2 Rabbit pAb

A14547-50ul 50 ul
EUR 223

GNAI2 Blocking Peptide

33R-2827 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI2 antibody, catalog no. 70R-5719

GNAI2 Blocking Peptide

33R-2830 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI2 antibody, catalog no. 70R-5712

GNAI2 Blocking Peptide

DF13045-BP 1mg
EUR 195

GNAI2 Conjugated Antibody

C43476 100ul
EUR 397

GNAI2 Conjugated Antibody

C43671 100ul
EUR 397

GNAI2 cloning plasmid

CSB-CL009589HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgggctgcaccgtgagcgccgaggacaaggcggcggccgagcgctctaagatgatcgacaagaacctgcgggaggacggagagaaggcggcgcgggaggtgaagttgctgctgttgggtgctggggagtcagggaagagcaccatcgtcaagcagatgaagatcatccacgagg
  • Show more
Description: A cloning plasmid for the GNAI2 gene.

GNAI2 cloning plasmid

CSB-CL009589HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgggctgcaccgtgagcgccgaggacaaggcggcggccgagcgctctaagatgatcgacaagaacctgcgggaggacggagagaaggcggcgcgggaggtgaagttgctgctgttgggtgctgtggagtcagggaagagcaccatcgtcaagcagatgaagatcatccacgagg
  • Show more
Description: A cloning plasmid for the GNAI2 gene.

GNAI2 cloning plasmid

CSB-CL009589HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1020
  • Sequence: atggagtatgcagggcatcttcctgccagctctgcccagggcaccatattggcatgcaccagctgcacaggtgctggggagtcagggaagagcaccatcgtcaagcagatgaagatcatccacgaggatggctactccgaggaggaatgccggcagtaccgggcggttgtctaca
  • Show more
Description: A cloning plasmid for the GNAI2 gene.

GNAI2 Rabbit pAb

A7676-100ul 100 ul
EUR 308

GNAI2 Rabbit pAb

A7676-200ul 200 ul
EUR 459

GNAI2 Rabbit pAb

A7676-20ul 20 ul
EUR 183

GNAI2 Rabbit pAb

A7676-50ul 50 ul
EUR 223

anti- GNAI2 antibody

FNab03532 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: guanine nucleotide binding protein(G protein), alpha inhibiting activity polypeptide 2
  • Uniprot ID: P04899
  • Gene ID: 2771
  • Research Area: Signal Transdu
  • Show more
Description: Antibody raised against GNAI2

Anti-GNAI2 antibody

PAab03532 100 ug
EUR 355

Anti-GNAI2 antibody

STJ116136 100 µl
EUR 277
Description: The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI2 antibody

STJ116758 100 µl
EUR 277
Description: The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI2 antibody

STJ29989 100 µl
EUR 277
Description: The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene.

GNAI2 protein (His tag)

80R-2472 50 ug
EUR 424
Description: Purified recombinant GNAI2 protein (His tag)

Canine GNAI2 ELISA KIT

ELI-09737d 96 Tests
EUR 928

Chicken GNAI2 ELISA KIT

ELI-12711c 96 Tests
EUR 928

Human GNAI2 ELISA KIT

ELI-27343h 96 Tests
EUR 824

GNAI2 ELISA KIT|Human

EF009907 96 Tests
EUR 689

Mouse Gnai2 ELISA KIT

ELI-43678m 96 Tests
EUR 865

Rat GNAI2 shRNA Plasmid

20-abx986638
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAI2 shRNA Plasmid

20-abx951842
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAI2 shRNA Plasmid

20-abx970575
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAI2 Recombinant Protein (Human)

RP013465 100 ug Ask for price

GNAI2 Recombinant Protein (Human)

RP013468 100 ug Ask for price

GNAI2 Recombinant Protein (Human)

RP013471 100 ug Ask for price

GNAI2 Recombinant Protein (Rat)

RP202946 100 ug Ask for price

GNAI2 Recombinant Protein (Mouse)

RP138899 100 ug Ask for price

Gnai2 ORF Vector (Rat) (pORF)

ORF067650 1.0 ug DNA
EUR 506

GNAI2 ORF Vector (Human) (pORF)

ORF004489 1.0 ug DNA
EUR 95

GNAI2 ORF Vector (Human) (pORF)

ORF004490 1.0 ug DNA
EUR 95

GNAI2 ORF Vector (Human) (pORF)

ORF004491 1.0 ug DNA
EUR 95