Human GAN(Gigaxonin) ELISA Kit

Contents

Human GAN(Gigaxonin) ELISA Kit 

Order Now: lieven@gentaur.com

Human Gigaxonin (GAN) ELISA Kit
DLR-GAN-Hu-96T 96T
EUR 673
  • Should the Human Gigaxonin (GAN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gigaxonin (GAN) in samples from tissue homogenates or other biological fluids.
Human Gigaxonin (GAN) ELISA Kit
RDR-GAN-Hu-48Tests 48 Tests
EUR 544
Human Gigaxonin (GAN) ELISA Kit
RDR-GAN-Hu-96Tests 96 Tests
EUR 756
Human Gigaxonin (GAN) ELISA Kit
RD-GAN-Hu-48Tests 48 Tests
EUR 521
Human Gigaxonin (GAN) ELISA Kit
RD-GAN-Hu-96Tests 96 Tests
EUR 723
Human Gigaxonin (GAN)ELISA Kit
201-12-2714 96 tests
EUR 440
  • This Gigaxonin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Gigaxonin (GAN) ELISA Kit
20-abx151662
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Gigaxonin, GAN ELISA KIT
ELI-32458h 96 Tests
EUR 824
Human Gigaxonin(GAN)ELISA Kit
QY-E04908 96T
EUR 361
Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.
Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.
Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.
Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.
Human Gigaxonin (GAN) ELISA Kit
4-SEJ068Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Gigaxonin elisa. Alternative names of the recognized antigen: GAN1
  • KLHL16
  • Giant Axonal Neuropathy
  • Kelch-like protein 16
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Gigaxonin (GAN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Gigaxonin (GAN) Antibody
20-abx003113
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Gigaxonin (GAN) Antibody
20-abx112713
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Gigaxonin (GAN) Antibody
20-abx128377
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Gigaxonin (GAN) Antibody
abx145835-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Gigaxonin (GAN) Antibody
20-abx172539
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Gigaxonin (GAN) Antibody
20-abx320505
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Gigaxonin (GAN) Antibody
abx233339-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Recombinant Gigaxonin (GAN)
4-RPJ068Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H2C0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Gigaxonin expressed in: E.coli
Mouse Gigaxonin (GAN) ELISA Kit
abx389398-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Gigaxonin, Gan ELISA KIT
ELI-48392m 96 Tests
EUR 865
ELISA kit for Human GAN (Gigaxonin)
ELK3607 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gigaxonin (GAN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gigaxonin (GAN). N
  • Show more
Description: A sandwich ELISA kit for detection of Gigaxonin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Gigaxonin (GAN) Protein
20-abx166536
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Gigaxonin (GAN) CLIA Kit
20-abx495603
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Gan ELISA Kit| Mouse Gigaxonin ELISA Kit
EF015031 96 Tests
EUR 689
Gigaxonin (GAN) Polyclonal Antibody (Human)
4-PAJ068Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN)
Gigaxonin (GAN) Polyclonal Antibody (Human), APC
4-PAJ068Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with APC.
Gigaxonin (GAN) Polyclonal Antibody (Human), Biotinylated
4-PAJ068Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with Biotin.
Gigaxonin (GAN) Polyclonal Antibody (Human), Cy3
4-PAJ068Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with Cy3.
Gigaxonin (GAN) Polyclonal Antibody (Human), FITC
4-PAJ068Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with FITC.
Gigaxonin (GAN) Polyclonal Antibody (Human), HRP
4-PAJ068Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with HRP.
Gigaxonin (GAN) Polyclonal Antibody (Human), PE
4-PAJ068Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with PE.
Gigaxonin (GAN) Polyclonal Antibody (Human), APC-Cy7
4-PAJ068Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with APC-Cy7.
GAN ELISA KIT|Human
EF009777 96 Tests
EUR 689
GAN ELISA Kit (Human) (OKCD00554)
OKCD00554 96 Wells
EUR 831
Description: Description of target: Probable cytoskeletal component that directly or indirectly plays an important role in neurofilament architecture. May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Controls degradation of TBCB. Controls degradation of MAP1B and MAP1S, and is critical for neuronal maintenance and survival.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"Microtubule-associated protein 1B: a neuronal binding partner for gigaxonin."_x005F_x005F_x000D_Ding J., Liu J.-J., Kowal A.S., Nardine T., Bhattacharya P., Lee A., Yang Y._x005F_x005F_x000D_J. Cell Biol. 158:427-433(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH MAP1B, SUBCELLULAR LOCATION, TISSUE SPECIFICITY.Ref.5"Gigaxonin interacts with tubulin folding cofactor B and controls its degradation through the ubiquitin-proteasome pathway."_x005F_x005F_x000D_Wang W., Ding J., Allen E., Zhu P., Zhang L., Vogel H., Yang Y._x005F_x005F_x000D_Curr. Biol. 15:2050-2055(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH TBCB, CHARACTERIZATION OF VARIANTS GAN1 SER-15; PHE-82 AND CYS-545.Ref.6"Ubiquitination of Keap1, a BTB-Kelch substrate adaptor protein for Cul3, targets Keap1 for degradation by a proteasome-independent pathway."_x005F_x005F_x000D_Zhang D.D., Lo S.C., Sun Z., Habib G.M., Lieberman M.W., Hannink M._x005F_x005F_x000D_J. Biol. Chem. 280:30091-30099(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, IDENTIFICATION IN A COMPLEX WITH CUL3 AND RBX1, UBIQUITINATION.Ref.7"Gigaxonin-controlled degradation of MAP1B light chain is critical to neuronal survival."_x005F_x005F_x000D_Allen E., Ding J., Wang W., Pramanik S., Chou J., Yau V., Yang Y._x005F_x005F_x000D_Nature 438:224-228(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH UBA1 AND MAP1B. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: protein ubiquitinationThis protein is involved in the pathway protein ubiquitination, which is part of Protein modification._x005F_x005F_x000D_View all proteins of this organism that are known to be involved in the pathway protein ubiquitination and in Protein modification. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL
GAN ELISA Kit (Human) (OKDD00281)
OKDD00281 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN).;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL
anti-Gigaxonin
YF-PA25049 50 ul
EUR 334
Description: Mouse polyclonal to Gigaxonin
Anti-Gigaxonin (4G7)
YF-MA16298 100 ug
EUR 363
Description: Mouse monoclonal to Gigaxonin
GAN antibody
70R-17420 50 ul
EUR 435
Description: Rabbit polyclonal GAN antibody
GAN antibody
43479-100ul 100ul
EUR 252
GAN antibody
43479-50ul 50ul
EUR 187
GAN antibody
70R-4075 50 ug
EUR 467
Description: Rabbit polyclonal GAN antibody raised against the middle region of GAN
GAN Antibody
1-CSB-PA009228ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GAN. Recognizes GAN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
GAN Antibody
1-CSB-PA009228GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GAN. Recognizes GAN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
GAN siRNA
20-abx917571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GAN siRNA
20-abx917572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human GAN shRNA Plasmid
20-abx955378
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GAN Recombinant Protein (Human)
RP012904 100 ug Ask for price
GAN Polyclonal Antibody
30534-100ul 100ul
EUR 252
GAN Polyclonal Antibody
30534-50ul 50ul
EUR 187
GAN Blocking Peptide
33R-4223 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GAN antibody, catalog no. 70R-4075
GAN cloning plasmid
CSB-CL009228HU-10ug 10ug
EUR 612
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1794
  • Sequence: atggctgagggcagtgccgtgtctgaccctcagcacgccgcgcgtctgctgcgagcgctcagctctttccgcgaggagtctcgcttctgcgacgcgcacctggtcctcgacggggaggagatcccggtgcagaagaacatcctggcggcggccagcccgtacatcaggacaaagt
  • Show more
Description: A cloning plasmid for the GAN gene.
GAN Rabbit pAb
A4205-100ul 100 ul
EUR 308
GAN Rabbit pAb
A4205-200ul 200 ul
EUR 459
GAN Rabbit pAb
A4205-20ul 20 ul
EUR 183
GAN Rabbit pAb
A4205-50ul 50 ul
EUR 223
anti- GAN antibody
FNab03339 100µg
EUR 548.75
  • Immunogen: gigaxonin
  • Uniprot ID: Q9H2C0
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against GAN
Anti-GAN antibody
PAab03339 100 ug
EUR 386
Anti-GAN antibody
STJ23745 100 µl
EUR 277
Description: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN).
GAN ORF Vector (Human) (pORF)
ORF004302 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
GAN Polyclonal Conjugated Antibody
C43479 100ul
EUR 397
GAN Polyclonal Conjugated Antibody
C30534 100ul
EUR 397
Mouse GAN shRNA Plasmid
20-abx980604
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GAN Recombinant Protein (Rat)
RP202226 100 ug Ask for price
GAN Recombinant Protein (Mouse)
RP135896 100 ug Ask for price
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
GAN sgRNA CRISPR Lentivector set (Human)
K0837701 3 x 1.0 ug
EUR 339
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Gan ORF Vector (Rat) (pORF)
ORF067410 1.0 ug DNA
EUR 506
Gan ORF Vector (Mouse) (pORF)
ORF045300 1.0 ug DNA
EUR 506
GAN sgRNA CRISPR Lentivector (Human) (Target 1)
K0837702 1.0 ug DNA
EUR 154
GAN sgRNA CRISPR Lentivector (Human) (Target 2)
K0837703 1.0 ug DNA
EUR 154
GAN sgRNA CRISPR Lentivector (Human) (Target 3)
K0837704 1.0 ug DNA
EUR 154
GAN Protein Vector (Human) (pPB-C-His)
PV017205 500 ng
EUR 329
GAN Protein Vector (Human) (pPB-N-His)
PV017206 500 ng
EUR 329
GAN Protein Vector (Human) (pPM-C-HA)
PV017207 500 ng
EUR 329
GAN Protein Vector (Human) (pPM-C-His)
PV017208 500 ng
EUR 329
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Gan sgRNA CRISPR Lentivector set (Rat)
K6058501 3 x 1.0 ug
EUR 339
Gan sgRNA CRISPR Lentivector set (Mouse)
K3108001 3 x 1.0 ug
EUR 339
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
Gan sgRNA CRISPR Lentivector (Rat) (Target 1)
K6058502 1.0 ug DNA
EUR 154
Gan sgRNA CRISPR Lentivector (Rat) (Target 2)
K6058503 1.0 ug DNA
EUR 154
Gan sgRNA CRISPR Lentivector (Rat) (Target 3)
K6058504 1.0 ug DNA
EUR 154
Gan sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3108002 1.0 ug DNA
EUR 154
Gan sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3108003 1.0 ug DNA
EUR 154
Gan sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3108004 1.0 ug DNA
EUR 154
GAN Protein Vector (Rat) (pPB-C-His)
PV269638 500 ng
EUR 603
GAN Protein Vector (Rat) (pPB-N-His)
PV269639 500 ng
EUR 603
GAN Protein Vector (Rat) (pPM-C-HA)
PV269640 500 ng
EUR 603
GAN Protein Vector (Rat) (pPM-C-His)
PV269641 500 ng
EUR 603
GAN Protein Vector (Mouse) (pPB-C-His)
PV181198 500 ng
EUR 603
GAN Protein Vector (Mouse) (pPB-N-His)
PV181199 500 ng
EUR 603
GAN Protein Vector (Mouse) (pPM-C-HA)
PV181200 500 ng
EUR 603
GAN Protein Vector (Mouse) (pPM-C-His)
PV181201 500 ng
EUR 603
Gan 3'UTR Luciferase Stable Cell Line
TU106903 1.0 ml Ask for price
Gan 3'UTR GFP Stable Cell Line
TU156903 1.0 ml Ask for price
Gan 3'UTR Luciferase Stable Cell Line
TU204945 1.0 ml Ask for price
Gan 3'UTR GFP Stable Cell Line
TU254945 1.0 ml Ask for price
GAN 3'UTR GFP Stable Cell Line
TU058547 1.0 ml
EUR 1521
GAN 3'UTR Luciferase Stable Cell Line
TU008547 1.0 ml
EUR 1521
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
GAN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0837705 3 x 1.0 ug
EUR 376
GAN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0837706 1.0 ug DNA
EUR 167
GAN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0837707 1.0 ug DNA
EUR 167
GAN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0837708 1.0 ug DNA
EUR 167
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6058505 3 x 1.0 ug
EUR 376
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3108005 3 x 1.0 ug
EUR 376
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6058506 1.0 ug DNA
EUR 167
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6058507 1.0 ug DNA
EUR 167
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6058508 1.0 ug DNA
EUR 167
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3108006 1.0 ug DNA
EUR 167
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3108007 1.0 ug DNA
EUR 167
Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3108008 1.0 ug DNA
EUR 167
AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Human Kit ELISA Kit
ELA-E0121h 96 Tests
EUR 824
Human KIT/SCFR ELISA kit
LF-EK50791 1×96T
EUR 648
KIT ELISA Kit (Human) (OKAN04574)
OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL
KIT ELISA Kit (Human) (OKCD06003)
OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL
Human Pentosidine ELISA Kit
201-12-0005 96 tests
EUR 440
  • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Amylin ELISA Kit
201-12-0017 96 tests
EUR 440
  • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human visfatin ELISA Kit
201-12-0026 96 tests
EUR 440
  • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Secretin ELISA Kit
201-12-0027 96 tests
EUR 440
  • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human omentin ELISA Kit
201-12-0156 96 tests
EUR 440
  • This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
human Resistin ELISA KIT
201-12-0339 96 tests
EUR 440
  • This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Collectin ELISA Kit
201-12-0354 96 tests
EUR 440
  • This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Agrin ELISA Kit
201-12-0414 96 tests
EUR 440
  • This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Thymosin ELISA Kit
201-12-0416 96 tests
EUR 440
  • This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human talin ELISA Kit
201-12-0620 96 tests
EUR 440
  • This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ponticulin ELISA Kit
201-12-0633 96 tests
EUR 440
  • This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Slit2 ELISA Kit
201-12-0662 96 tests
EUR 440
  • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human trypsin ELISA Kit
201-12-0805 96 tests
EUR 440
  • This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Elastase ELISA Kit
201-12-0812 96 tests
EUR 440
  • This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ?-glucosidase ELISA Kit
201-12-0854 96 tests
EUR 440
  • This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ?-lactamase ELISA Kit
201-12-0856 96 tests
EUR 440
  • This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Methylase ELISA Kit
201-12-0927 96 tests
EUR 440
  • This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Pancreastatin ELISA Kit
201-12-0984 96 tests
EUR 440
  • This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Cortisol ELISA Kit
201-12-1004 96 tests
EUR 440
  • This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Renin ELISA Kit
201-12-1017 96 tests
EUR 440
  • This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human podocin ELISA Kit
201-12-1083 96 tests
EUR 440
  • This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Nephrin ELISA Kit
201-12-1092 96 tests
EUR 440
  • This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human gelson ELISA Kit
201-12-1204 96 tests
EUR 440
  • This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Salusin ? ELISA Kit
201-12-1269 96 tests
EUR 440
  • This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Salusin-? ELISA Kit
201-12-1273 96 tests
EUR 440
  • This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human chemerin ELISA Kit
201-12-1436 96 tests
EUR 440
  • This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human dystrophin ELISA Kit
201-12-1446 96 tests
EUR 440
  • This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human preptin ELISA Kit
201-12-1449 96 tests
EUR 440
  • This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human p16 ELISA Kit
201-12-1638 96 tests
EUR 440
  • This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
human colicin ELISA Kit
201-12-1747 96 tests
EUR 440
  • This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Amebiasis ELISA Kit
201-12-1748 96 tests
EUR 440
  • This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
human schistosoma ELISA Kit
201-12-1749 96 tests
EUR 440
  • This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Enterovirus ELISA Kit
201-12-1809 96 tests
EUR 440
  • This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human flagellin ELISA Kit
201-12-1815 96 tests
EUR 440
  • This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Cotinine ELISA Kit
201-12-2044 96 tests
EUR 440
  • This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Myostatin ELISA Kit
201-12-2092 96 tests
EUR 440
  • This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Haponin ELISA Kit
201-12-2740 96 tests
EUR 440
  • This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ANG ELISA Kit
55R-1555 1 kit
EUR 651
Description: ELISA kit for detection of ANG in the research laboratory
Human BDNF ELISA Kit
55R-1556 1 kit
EUR 428
Description: ELISA kit for detection of BDNF in the research laboratory
Human BMP5 ELISA Kit
55R-1559 1 kit
EUR 624
Description: ELISA kit for detection of BMP-5 in the research laboratory
Human BMP2 ELISA Kit
55R-1560 1 kit
EUR 624
Description: ELISA kit for detection of BMP2 in the research laboratory
Human BMP4 ELISA Kit
55R-1563 1 kit
EUR 651
Description: ELISA Kit for detection of BMP4 in the research laboratory