Human GAN(Gigaxonin) ELISA Kit 

Order Now: lieven@gentaur.com

Human Gigaxonin (GAN) ELISA Kit
DLR-GAN-Hu-96T	DL Develop	96T	EUR 673
Should the Human Gigaxonin (GAN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gigaxonin (GAN) in samples from tissue homogenates or other biological fluids.

Human Gigaxonin (GAN) ELISA Kit
RDR-GAN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Gigaxonin (GAN) ELISA Kit
RDR-GAN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Gigaxonin (GAN) ELISA Kit
RD-GAN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Gigaxonin (GAN) ELISA Kit
RD-GAN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Gigaxonin (GAN)ELISA Kit
201-12-2714	SunredBio	96 tests	EUR 440
This Gigaxonin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Gigaxonin (GAN) ELISA Kit
20-abx151662	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Gigaxonin, GAN ELISA KIT
ELI-32458h	Lifescience Market	96 Tests	EUR 824

Human Gigaxonin(GAN)ELISA Kit
QY-E04908	Qayee Biotechnology	96T	EUR 361

Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit
SEJ068Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit
4-SEJ068Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Gigaxonin elisa. Alternative names of the recognized antigen: GAN1 KLHL16 Giant Axonal Neuropathy Kelch-like protein 16
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Gigaxonin (GAN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Gigaxonin (GAN) Antibody
20-abx003113	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody
20-abx112713	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody
20-abx128377	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Gigaxonin (GAN) Antibody
abx145835-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody
20-abx172539	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Gigaxonin (GAN) Antibody
20-abx320505	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody
abx233339-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Gigaxonin (GAN)
4-RPJ068Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H2C0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Gigaxonin expressed in: E.coli

Mouse Gigaxonin (GAN) ELISA Kit
abx389398-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Gigaxonin, Gan ELISA KIT
ELI-48392m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human GAN (Gigaxonin)
ELK3607	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gigaxonin (GAN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gigaxonin (GAN). N Show more
Description: A sandwich ELISA kit for detection of Gigaxonin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Gigaxonin (GAN) Protein
20-abx166536	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Gigaxonin (GAN) CLIA Kit
20-abx495603	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Gan ELISA Kit| Mouse Gigaxonin ELISA Kit
EF015031	Lifescience Market	96 Tests	EUR 689

Gigaxonin (GAN) Polyclonal Antibody (Human)
4-PAJ068Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN)

Gigaxonin (GAN) Polyclonal Antibody (Human), APC
4-PAJ068Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with APC.

Gigaxonin (GAN) Polyclonal Antibody (Human), Biotinylated
4-PAJ068Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with Biotin.

Gigaxonin (GAN) Polyclonal Antibody (Human), Cy3
4-PAJ068Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with Cy3.

Gigaxonin (GAN) Polyclonal Antibody (Human), FITC
4-PAJ068Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with FITC.

Gigaxonin (GAN) Polyclonal Antibody (Human), HRP
4-PAJ068Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with HRP.

Gigaxonin (GAN) Polyclonal Antibody (Human), PE
4-PAJ068Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with PE.

Gigaxonin (GAN) Polyclonal Antibody (Human), APC-Cy7
4-PAJ068Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GAN (Cys30~Gly326) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with APC-Cy7.

GAN ELISA KIT|Human
EF009777	Lifescience Market	96 Tests	EUR 689

GAN ELISA Kit (Human) (OKCD00554)
OKCD00554	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Probable cytoskeletal component that directly or indirectly plays an important role in neurofilament architecture. May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Controls degradation of TBCB. Controls degradation of MAP1B and MAP1S, and is critical for neuronal maintenance and survival.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"Microtubule-associated protein 1B: a neuronal binding partner for gigaxonin."_x005F_x005F_x000D_Ding J., Liu J.-J., Kowal A.S., Nardine T., Bhattacharya P., Lee A., Yang Y._x005F_x005F_x000D_J. Cell Biol. 158:427-433(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH MAP1B, SUBCELLULAR LOCATION, TISSUE SPECIFICITY.Ref.5"Gigaxonin interacts with tubulin folding cofactor B and controls its degradation through the ubiquitin-proteasome pathway."_x005F_x005F_x000D_Wang W., Ding J., Allen E., Zhu P., Zhang L., Vogel H., Yang Y._x005F_x005F_x000D_Curr. Biol. 15:2050-2055(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH TBCB, CHARACTERIZATION OF VARIANTS GAN1 SER-15; PHE-82 AND CYS-545.Ref.6"Ubiquitination of Keap1, a BTB-Kelch substrate adaptor protein for Cul3, targets Keap1 for degradation by a proteasome-independent pathway."_x005F_x005F_x000D_Zhang D.D., Lo S.C., Sun Z., Habib G.M., Lieberman M.W., Hannink M._x005F_x005F_x000D_J. Biol. Chem. 280:30091-30099(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, IDENTIFICATION IN A COMPLEX WITH CUL3 AND RBX1, UBIQUITINATION.Ref.7"Gigaxonin-controlled degradation of MAP1B light chain is critical to neuronal survival."_x005F_x005F_x000D_Allen E., Ding J., Wang W., Pramanik S., Chou J., Yau V., Yang Y._x005F_x005F_x000D_Nature 438:224-228(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH UBA1 AND MAP1B. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: protein ubiquitinationThis protein is involved in the pathway protein ubiquitination, which is part of Protein modification._x005F_x005F_x000D_View all proteins of this organism that are known to be involved in the pathway protein ubiquitination and in Protein modification. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

GAN ELISA Kit (Human) (OKDD00281)
OKDD00281	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN).;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

anti-Gigaxonin
YF-PA25049	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Gigaxonin

Anti-Gigaxonin (4G7)
YF-MA16298	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Gigaxonin

GAN antibody
70R-17420	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GAN antibody

GAN antibody
43479-100ul	SAB	100ul	EUR 252

GAN antibody
43479-50ul	SAB	50ul	EUR 187

GAN antibody
70R-4075	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GAN antibody raised against the middle region of GAN

GAN Antibody
1-CSB-PA009228ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GAN. Recognizes GAN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GAN Antibody
1-CSB-PA009228GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GAN. Recognizes GAN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GAN siRNA
20-abx917571	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GAN siRNA
20-abx917572	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human GAN shRNA Plasmid
20-abx955378	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GAN Recombinant Protein (Human)
RP012904	ABM	100 ug	Ask for price

GAN Polyclonal Antibody
30534-100ul	SAB	100ul	EUR 252

GAN Polyclonal Antibody
30534-50ul	SAB	50ul	EUR 187

GAN Blocking Peptide
33R-4223	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GAN antibody, catalog no. 70R-4075

GAN cloning plasmid
CSB-CL009228HU-10ug	Cusabio	10ug	EUR 612
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1794 Sequence: atggctgagggcagtgccgtgtctgaccctcagcacgccgcgcgtctgctgcgagcgctcagctctttccgcgaggagtctcgcttctgcgacgcgcacctggtcctcgacggggaggagatcccggtgcagaagaacatcctggcggcggccagcccgtacatcaggacaaagt Show more
Description: A cloning plasmid for the GAN gene.

GAN Rabbit pAb
A4205-100ul	Abclonal	100 ul	EUR 308

GAN Rabbit pAb
A4205-200ul	Abclonal	200 ul	EUR 459

GAN Rabbit pAb
A4205-20ul	Abclonal	20 ul	EUR 183

GAN Rabbit pAb
A4205-50ul	Abclonal	50 ul	EUR 223

anti- GAN antibody
FNab03339	FN Test	100µg	EUR 548.75
Immunogen: gigaxonin Uniprot ID: Q9H2C0 Research Area: Neuroscience, Metabolism
Description: Antibody raised against GAN

Anti-GAN antibody
PAab03339	Lifescience Market	100 ug	EUR 386

Anti-GAN antibody
STJ23745	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN).

GAN ORF Vector (Human) (pORF)
ORF004302	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

GAN Polyclonal Conjugated Antibody
C43479	SAB	100ul	EUR 397

GAN Polyclonal Conjugated Antibody
C30534	SAB	100ul	EUR 397

Mouse GAN shRNA Plasmid
20-abx980604	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GAN Recombinant Protein (Rat)
RP202226	ABM	100 ug	Ask for price

GAN Recombinant Protein (Mouse)
RP135896	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

GAN sgRNA CRISPR Lentivector set (Human)
K0837701	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Gan ORF Vector (Rat) (pORF)
ORF067410	ABM	1.0 ug DNA	EUR 506

Gan ORF Vector (Mouse) (pORF)
ORF045300	ABM	1.0 ug DNA	EUR 506

GAN sgRNA CRISPR Lentivector (Human) (Target 1)
K0837702	ABM	1.0 ug DNA	EUR 154

GAN sgRNA CRISPR Lentivector (Human) (Target 2)
K0837703	ABM	1.0 ug DNA	EUR 154

GAN sgRNA CRISPR Lentivector (Human) (Target 3)
K0837704	ABM	1.0 ug DNA	EUR 154

GAN Protein Vector (Human) (pPB-C-His)
PV017205	ABM	500 ng	EUR 329

GAN Protein Vector (Human) (pPB-N-His)
PV017206	ABM	500 ng	EUR 329

GAN Protein Vector (Human) (pPM-C-HA)
PV017207	ABM	500 ng	EUR 329

GAN Protein Vector (Human) (pPM-C-His)
PV017208	ABM	500 ng	EUR 329

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Gan sgRNA CRISPR Lentivector set (Rat)
K6058501	ABM	3 x 1.0 ug	EUR 339

Gan sgRNA CRISPR Lentivector set (Mouse)
K3108001	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Gan sgRNA CRISPR Lentivector (Rat) (Target 1)
K6058502	ABM	1.0 ug DNA	EUR 154

Gan sgRNA CRISPR Lentivector (Rat) (Target 2)
K6058503	ABM	1.0 ug DNA	EUR 154

Gan sgRNA CRISPR Lentivector (Rat) (Target 3)
K6058504	ABM	1.0 ug DNA	EUR 154

Gan sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3108002	ABM	1.0 ug DNA	EUR 154

Gan sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3108003	ABM	1.0 ug DNA	EUR 154

Gan sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3108004	ABM	1.0 ug DNA	EUR 154

GAN Protein Vector (Rat) (pPB-C-His)
PV269638	ABM	500 ng	EUR 603

GAN Protein Vector (Rat) (pPB-N-His)
PV269639	ABM	500 ng	EUR 603

GAN Protein Vector (Rat) (pPM-C-HA)
PV269640	ABM	500 ng	EUR 603

GAN Protein Vector (Rat) (pPM-C-His)
PV269641	ABM	500 ng	EUR 603

GAN Protein Vector (Mouse) (pPB-C-His)
PV181198	ABM	500 ng	EUR 603

GAN Protein Vector (Mouse) (pPB-N-His)
PV181199	ABM	500 ng	EUR 603

GAN Protein Vector (Mouse) (pPM-C-HA)
PV181200	ABM	500 ng	EUR 603

GAN Protein Vector (Mouse) (pPM-C-His)
PV181201	ABM	500 ng	EUR 603

Gan 3'UTR Luciferase Stable Cell Line
TU106903	ABM	1.0 ml	Ask for price

Gan 3'UTR GFP Stable Cell Line
TU156903	ABM	1.0 ml	Ask for price

Gan 3'UTR Luciferase Stable Cell Line
TU204945	ABM	1.0 ml	Ask for price

Gan 3'UTR GFP Stable Cell Line
TU254945	ABM	1.0 ml	Ask for price

GAN 3'UTR GFP Stable Cell Line
TU058547	ABM	1.0 ml	EUR 1521

GAN 3'UTR Luciferase Stable Cell Line
TU008547	ABM	1.0 ml	EUR 1521

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

GAN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0837705	ABM	3 x 1.0 ug	EUR 376

GAN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0837706	ABM	1.0 ug DNA	EUR 167

GAN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0837707	ABM	1.0 ug DNA	EUR 167

GAN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0837708	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6058505	ABM	3 x 1.0 ug	EUR 376

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3108005	ABM	3 x 1.0 ug	EUR 376

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6058506	ABM	1.0 ug DNA	EUR 167

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6058507	ABM	1.0 ug DNA	EUR 167

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6058508	ABM	1.0 ug DNA	EUR 167

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3108006	ABM	1.0 ug DNA	EUR 167

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3108007	ABM	1.0 ug DNA	EUR 167

Gan sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3108008	ABM	1.0 ug DNA	EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit
201-12-0005	SunredBio	96 tests	EUR 440
This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit
201-12-0017	SunredBio	96 tests	EUR 440
This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit
201-12-0026	SunredBio	96 tests	EUR 440
This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit
201-12-0027	SunredBio	96 tests	EUR 440
This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human omentin ELISA Kit
201-12-0156	SunredBio	96 tests	EUR 440
This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human Resistin ELISA KIT
201-12-0339	SunredBio	96 tests	EUR 440
This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Collectin ELISA Kit
201-12-0354	SunredBio	96 tests	EUR 440
This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Agrin ELISA Kit
201-12-0414	SunredBio	96 tests	EUR 440
This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thymosin ELISA Kit
201-12-0416	SunredBio	96 tests	EUR 440
This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human talin ELISA Kit
201-12-0620	SunredBio	96 tests	EUR 440
This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ponticulin ELISA Kit
201-12-0633	SunredBio	96 tests	EUR 440
This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit2 ELISA Kit
201-12-0662	SunredBio	96 tests	EUR 440
This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human trypsin ELISA Kit
201-12-0805	SunredBio	96 tests	EUR 440
This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Elastase ELISA Kit
201-12-0812	SunredBio	96 tests	EUR 440
This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-glucosidase ELISA Kit
201-12-0854	SunredBio	96 tests	EUR 440
This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-lactamase ELISA Kit
201-12-0856	SunredBio	96 tests	EUR 440
This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Methylase ELISA Kit
201-12-0927	SunredBio	96 tests	EUR 440
This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Pancreastatin ELISA Kit
201-12-0984	SunredBio	96 tests	EUR 440
This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cortisol ELISA Kit
201-12-1004	SunredBio	96 tests	EUR 440
This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Renin ELISA Kit
201-12-1017	SunredBio	96 tests	EUR 440
This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human podocin ELISA Kit
201-12-1083	SunredBio	96 tests	EUR 440
This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Nephrin ELISA Kit
201-12-1092	SunredBio	96 tests	EUR 440
This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human gelson ELISA Kit
201-12-1204	SunredBio	96 tests	EUR 440
This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Salusin ? ELISA Kit
201-12-1269	SunredBio	96 tests	EUR 440
This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Salusin-? ELISA Kit
201-12-1273	SunredBio	96 tests	EUR 440
This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chemerin ELISA Kit
201-12-1436	SunredBio	96 tests	EUR 440
This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human dystrophin ELISA Kit
201-12-1446	SunredBio	96 tests	EUR 440
This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human preptin ELISA Kit
201-12-1449	SunredBio	96 tests	EUR 440
This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human p16 ELISA Kit
201-12-1638	SunredBio	96 tests	EUR 440
This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human colicin ELISA Kit
201-12-1747	SunredBio	96 tests	EUR 440
This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amebiasis ELISA Kit
201-12-1748	SunredBio	96 tests	EUR 440
This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human schistosoma ELISA Kit
201-12-1749	SunredBio	96 tests	EUR 440
This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Enterovirus ELISA Kit
201-12-1809	SunredBio	96 tests	EUR 440
This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human flagellin ELISA Kit
201-12-1815	SunredBio	96 tests	EUR 440
This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cotinine ELISA Kit
201-12-2044	SunredBio	96 tests	EUR 440
This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Myostatin ELISA Kit
201-12-2092	SunredBio	96 tests	EUR 440
This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Haponin ELISA Kit
201-12-2740	SunredBio	96 tests	EUR 440
This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ANG ELISA Kit
55R-1555	Fitzgerald	1 kit	EUR 651
Description: ELISA kit for detection of ANG in the research laboratory

Human BDNF ELISA Kit
55R-1556	Fitzgerald	1 kit	EUR 428
Description: ELISA kit for detection of BDNF in the research laboratory

Human BMP5 ELISA Kit
55R-1559	Fitzgerald	1 kit	EUR 624
Description: ELISA kit for detection of BMP-5 in the research laboratory

Human BMP2 ELISA Kit
55R-1560	Fitzgerald	1 kit	EUR 624
Description: ELISA kit for detection of BMP2 in the research laboratory

Human BMP4 ELISA Kit
55R-1563	Fitzgerald	1 kit	EUR 651
Description: ELISA Kit for detection of BMP4 in the research laboratory