TMED9

TMED9 siRNA
20-abx937007
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMED9 siRNA
20-abx937008
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMED9 antibody
70R-20861 50 ul
EUR 435
Description: Rabbit polyclonal TMED9 antibody
TMED9 antibody
23133-100ul 100ul
EUR 390
TMED9 antibody
70R-12650 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TMED9 antibody
TMED9 Antibody
1-CSB-PA04804A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
TMED9 Antibody
1-CSB-PA023665GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
anti- TMED9 antibody
FNab08741 100µg
EUR 548.75
  • Immunogen: transmembrane emp24 protein transport domain containing 9
  • Uniprot ID: Q9BVK6
  • Gene ID: 54732
  • Research Area: Signal Transduction
Description: Antibody raised against TMED9
TMED9 Polyclonal Antibody
A53113 100 µg
EUR 570.55
Description: The best epigenetics products
TMED9 Rabbit pAb
A3442-100ul 100 ul
EUR 308
TMED9 Rabbit pAb
A3442-200ul 200 ul
EUR 459
TMED9 Rabbit pAb
A3442-20ul 20 ul
EUR 183
TMED9 Rabbit pAb
A3442-50ul 50 ul
EUR 223
TMED9 Polyclonal Antibody
30454-100ul 100ul
EUR 252
TMED9 Polyclonal Antibody
30454-50ul 50ul
EUR 187
TMED9 cloning plasmid
CSB-CL880113HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 708
  • Sequence: atggctgtggagctgggcgtgctgctcgtccggccccggcccggaaccgggctgggtagagtgatgcggaccctcctgctggtgctgtggctggcgacgcgcggaagcgcgctctactttcacatcggagagacggagaagaagtgctttattgaggagatcccggacgagaccat
  • Show more
Description: A cloning plasmid for the TMED9 gene.
Anti-TMED9 antibody
PAab08741 100 ug
EUR 386
Anti-TMED9 antibody
STJ116207 100 µl
EUR 277
TMED9 Polyclonal Conjugated Antibody
C30454 100ul
EUR 397
Mouse TMED9 shRNA Plasmid
20-abx976189
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TMED9 shRNA Plasmid
20-abx990162
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine TMED9 ELISA KIT
ELI-16305b 96 Tests
EUR 928
TMED9 ELISA KIT|Human
EF003644 96 Tests
EUR 689
Mouse Tmed9 ELISA KIT
ELI-45968m 96 Tests
EUR 865
Human TMED9 ELISA KIT
ELI-40130h 96 Tests
EUR 824
Human TMED9 shRNA Plasmid
20-abx960185
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TMED9 Antibody, HRP conjugated
1-CSB-PA04804B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TMED9 Antibody, FITC conjugated
1-CSB-PA04804C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TMED9 Antibody, Biotin conjugated
1-CSB-PA04804D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TMED9 Recombinant Protein (Human)
RP031834 100 ug Ask for price
TMED9 Recombinant Protein (Rat)
RP233405 100 ug Ask for price
TMED9 Recombinant Protein (Mouse)
RP179171 100 ug Ask for price
TMED9 Polyclonal Antibody, Biotin Conjugated
A53110 100 µg
EUR 570.55
Description: Ask the seller for details
TMED9 Polyclonal Antibody, FITC Conjugated
A53111 100 µg
EUR 570.55
Description: The best epigenetics products
TMED9 Polyclonal Antibody, HRP Conjugated
A53112 100 µg
EUR 570.55
Description: kits suitable for this type of research
Tmed9 ORF Vector (Mouse) (pORF)
ORF059725 1.0 ug DNA
EUR 506
TMED9 ORF Vector (Human) (pORF)
ORF010612 1.0 ug DNA
EUR 95
Tmed9 ORF Vector (Rat) (pORF)
ORF077803 1.0 ug DNA
EUR 506
TMED9 sgRNA CRISPR Lentivector set (Human)
K2385801 3 x 1.0 ug
EUR 339
Tmed9 sgRNA CRISPR Lentivector set (Rat)
K7464901 3 x 1.0 ug
EUR 339
Tmed9 sgRNA CRISPR Lentivector set (Mouse)
K4938601 3 x 1.0 ug
EUR 339
TMED9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385802 1.0 ug DNA
EUR 154
TMED9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385803 1.0 ug DNA
EUR 154
TMED9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385804 1.0 ug DNA
EUR 154
Tmed9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7464902 1.0 ug DNA
EUR 154
Tmed9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7464903 1.0 ug DNA
EUR 154
Tmed9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7464904 1.0 ug DNA
EUR 154
Tmed9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4938602 1.0 ug DNA
EUR 154
Tmed9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4938603 1.0 ug DNA
EUR 154
Tmed9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4938604 1.0 ug DNA
EUR 154
TMED9 Protein Vector (Human) (pPB-C-His)
PV042445 500 ng
EUR 329
TMED9 Protein Vector (Human) (pPB-N-His)
PV042446 500 ng
EUR 329
TMED9 Protein Vector (Human) (pPM-C-HA)
PV042447 500 ng
EUR 329
TMED9 Protein Vector (Human) (pPM-C-His)
PV042448 500 ng
EUR 329
TMED9 Protein Vector (Rat) (pPB-C-His)
PV311210 500 ng
EUR 603
TMED9 Protein Vector (Rat) (pPB-N-His)
PV311211 500 ng
EUR 603
TMED9 Protein Vector (Rat) (pPM-C-HA)
PV311212 500 ng
EUR 603
TMED9 Protein Vector (Rat) (pPM-C-His)
PV311213 500 ng
EUR 603
TMED9 Protein Vector (Mouse) (pPB-C-His)
PV238898 500 ng
EUR 603
TMED9 Protein Vector (Mouse) (pPB-N-His)
PV238899 500 ng
EUR 603
TMED9 Protein Vector (Mouse) (pPM-C-HA)
PV238900 500 ng
EUR 603
TMED9 Protein Vector (Mouse) (pPM-C-His)
PV238901 500 ng
EUR 603
Tmed9 3'UTR GFP Stable Cell Line
TU170606 1.0 ml Ask for price
TMED9 3'UTR GFP Stable Cell Line
TU075704 1.0 ml
EUR 1394
Tmed9 3'UTR Luciferase Stable Cell Line
TU120606 1.0 ml Ask for price
TMED9 3'UTR Luciferase Stable Cell Line
TU025704 1.0 ml
EUR 1394
Tmed9 3'UTR Luciferase Stable Cell Line
TU221991 1.0 ml Ask for price
Tmed9 3'UTR GFP Stable Cell Line
TU271991 1.0 ml Ask for price
Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
20-abx116229
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
20-abx002470
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
abx145019-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
abx238741-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TMED9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695845 1.0 ug DNA
EUR 514
TMED9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695849 1.0 ug DNA
EUR 514
TMED9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695850 1.0 ug DNA
EUR 514