TMED9 siRNA
20-abx937007	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMED9 siRNA
20-abx937008	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMED9 antibody
70R-20861	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TMED9 antibody

TMED9 antibody
23133-100ul	SAB	100ul	EUR 390

TMED9 antibody
70R-12650	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TMED9 antibody

TMED9 Antibody
1-CSB-PA04804A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

TMED9 Antibody
1-CSB-PA023665GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

anti- TMED9 antibody
FNab08741	FN Test	100µg	EUR 548.75
Immunogen: transmembrane emp24 protein transport domain containing 9 Uniprot ID: Q9BVK6 Gene ID: 54732 Research Area: Signal Transduction
Description: Antibody raised against TMED9

TMED9 Polyclonal Antibody
A53113	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TMED9 Rabbit pAb
A3442-100ul	Abclonal	100 ul	EUR 308

TMED9 Rabbit pAb
A3442-200ul	Abclonal	200 ul	EUR 459

TMED9 Rabbit pAb
A3442-20ul	Abclonal	20 ul	EUR 183

TMED9 Rabbit pAb
A3442-50ul	Abclonal	50 ul	EUR 223

TMED9 Polyclonal Antibody
30454-100ul	SAB	100ul	EUR 252

TMED9 Polyclonal Antibody
30454-50ul	SAB	50ul	EUR 187

TMED9 cloning plasmid
CSB-CL880113HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 708 Sequence: atggctgtggagctgggcgtgctgctcgtccggccccggcccggaaccgggctgggtagagtgatgcggaccctcctgctggtgctgtggctggcgacgcgcggaagcgcgctctactttcacatcggagagacggagaagaagtgctttattgaggagatcccggacgagaccat Show more
Description: A cloning plasmid for the TMED9 gene.

Anti-TMED9 antibody
PAab08741	Lifescience Market	100 ug	EUR 386

Anti-TMED9 antibody
STJ116207	St John's Laboratory	100 µl	EUR 277

TMED9 Polyclonal Conjugated Antibody
C30454	SAB	100ul	EUR 397

Mouse TMED9 shRNA Plasmid
20-abx976189	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TMED9 shRNA Plasmid
20-abx990162	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine TMED9 ELISA KIT
ELI-16305b	Lifescience Market	96 Tests	EUR 928

TMED9 ELISA KIT|Human
EF003644	Lifescience Market	96 Tests	EUR 689

Mouse Tmed9 ELISA KIT
ELI-45968m	Lifescience Market	96 Tests	EUR 865

Human TMED9 ELISA KIT
ELI-40130h	Lifescience Market	96 Tests	EUR 824

Human TMED9 shRNA Plasmid
20-abx960185	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMED9 Antibody, HRP conjugated
1-CSB-PA04804B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TMED9 Antibody, FITC conjugated
1-CSB-PA04804C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TMED9 Antibody, Biotin conjugated
1-CSB-PA04804D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMED9. Recognizes TMED9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TMED9 Recombinant Protein (Human)
RP031834	ABM	100 ug	Ask for price

TMED9 Recombinant Protein (Rat)
RP233405	ABM	100 ug	Ask for price

TMED9 Recombinant Protein (Mouse)
RP179171	ABM	100 ug	Ask for price

TMED9 Polyclonal Antibody, Biotin Conjugated
A53110	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TMED9 Polyclonal Antibody, FITC Conjugated
A53111	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TMED9 Polyclonal Antibody, HRP Conjugated
A53112	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Tmed9 ORF Vector (Mouse) (pORF)
ORF059725	ABM	1.0 ug DNA	EUR 506

TMED9 ORF Vector (Human) (pORF)
ORF010612	ABM	1.0 ug DNA	EUR 95

Tmed9 ORF Vector (Rat) (pORF)
ORF077803	ABM	1.0 ug DNA	EUR 506

TMED9 sgRNA CRISPR Lentivector set (Human)
K2385801	ABM	3 x 1.0 ug	EUR 339

Tmed9 sgRNA CRISPR Lentivector set (Rat)
K7464901	ABM	3 x 1.0 ug	EUR 339

Tmed9 sgRNA CRISPR Lentivector set (Mouse)
K4938601	ABM	3 x 1.0 ug	EUR 339

TMED9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385802	ABM	1.0 ug DNA	EUR 154

TMED9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385803	ABM	1.0 ug DNA	EUR 154

TMED9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385804	ABM	1.0 ug DNA	EUR 154

Tmed9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7464902	ABM	1.0 ug DNA	EUR 154

Tmed9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7464903	ABM	1.0 ug DNA	EUR 154

Tmed9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7464904	ABM	1.0 ug DNA	EUR 154

Tmed9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4938602	ABM	1.0 ug DNA	EUR 154

Tmed9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4938603	ABM	1.0 ug DNA	EUR 154

Tmed9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4938604	ABM	1.0 ug DNA	EUR 154

TMED9 Protein Vector (Human) (pPB-C-His)
PV042445	ABM	500 ng	EUR 329

TMED9 Protein Vector (Human) (pPB-N-His)
PV042446	ABM	500 ng	EUR 329

TMED9 Protein Vector (Human) (pPM-C-HA)
PV042447	ABM	500 ng	EUR 329

TMED9 Protein Vector (Human) (pPM-C-His)
PV042448	ABM	500 ng	EUR 329

TMED9 Protein Vector (Rat) (pPB-C-His)
PV311210	ABM	500 ng	EUR 603

TMED9 Protein Vector (Rat) (pPB-N-His)
PV311211	ABM	500 ng	EUR 603

TMED9 Protein Vector (Rat) (pPM-C-HA)
PV311212	ABM	500 ng	EUR 603

TMED9 Protein Vector (Rat) (pPM-C-His)
PV311213	ABM	500 ng	EUR 603

TMED9 Protein Vector (Mouse) (pPB-C-His)
PV238898	ABM	500 ng	EUR 603

TMED9 Protein Vector (Mouse) (pPB-N-His)
PV238899	ABM	500 ng	EUR 603

TMED9 Protein Vector (Mouse) (pPM-C-HA)
PV238900	ABM	500 ng	EUR 603

TMED9 Protein Vector (Mouse) (pPM-C-His)
PV238901	ABM	500 ng	EUR 603

Tmed9 3'UTR GFP Stable Cell Line
TU170606	ABM	1.0 ml	Ask for price

TMED9 3'UTR GFP Stable Cell Line
TU075704	ABM	1.0 ml	EUR 1394

Tmed9 3'UTR Luciferase Stable Cell Line
TU120606	ABM	1.0 ml	Ask for price

TMED9 3'UTR Luciferase Stable Cell Line
TU025704	ABM	1.0 ml	EUR 1394

Tmed9 3'UTR Luciferase Stable Cell Line
TU221991	ABM	1.0 ml	Ask for price

Tmed9 3'UTR GFP Stable Cell Line
TU271991	ABM	1.0 ml	Ask for price

Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
20-abx116229	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
20-abx002470	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
abx145019-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Transmembrane Emp24 Domain-Containing Protein 9 (TMED9) Antibody
abx238741-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

TMED9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695845	ABM	1.0 ug DNA	EUR 514

TMED9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695849	ABM	1.0 ug DNA	EUR 514

TMED9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695850	ABM	1.0 ug DNA	EUR 514