RPL32

RPL32 antibody

70R-19980 50 ul
EUR 435
Description: Rabbit polyclonal RPL32 antibody

RPL32 antibody

70R-1471 100 ug
EUR 377
Description: Rabbit polyclonal RPL32 antibody raised against the N terminal of RPL32

RPL32 siRNA

20-abx931958
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL32 siRNA

20-abx931959
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL32 Antibody

1-CSB-PA020237GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL32. Recognizes RPL32 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-RPL32

YF-PA24610 50 ul
EUR 334
Description: Mouse polyclonal to RPL32

RPL32 cloning plasmid

CSB-CL020237HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atggccgccctcagaccccttgtgaagcccaagatcgtcaaaaagagaaccaagaagttcatccggcaccagtcagaccgatatgtcaaaattaagcgtaactggcggaaacccagaggcattgacaacagggttcgtagaagattcaagggccagatcttgatgcccaacattgg
  • Show more
Description: A cloning plasmid for the RPL32 gene.

anti- RPL32 antibody

FNab07433 100µg
EUR 548.75
  • Immunogen: ribosomal protein L32
  • Uniprot ID: P62910
  • Gene ID: 6161
  • Research Area: Metabolism
Description: Antibody raised against RPL32

RPL32 Rabbit pAb

A13001-100ul 100 ul
EUR 308

RPL32 Rabbit pAb

A13001-200ul 200 ul
EUR 459

RPL32 Rabbit pAb

A13001-20ul 20 ul
EUR 183

RPL32 Rabbit pAb

A13001-50ul 50 ul
EUR 223

RPL32 Blocking Peptide

33R-1035 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM166 antibody, catalog no. 70R-9643

RPL32 Polyclonal Antibody

27860-100ul 100ul
EUR 252

RPL32 Polyclonal Antibody

27860-50ul 50ul
EUR 187

Anti-RPL32 antibody

PAab07433 100 ug
EUR 386

pCMV-SPORT6-RPL32

PVT13699 2 ug
EUR 391

Anti-RPL32 antibody

STJ114970 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. It is located in the cytoplasm. Although some studies have mapped this gene to 3q13.3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for this gene.

Anti-RPL32 (1C3)

YF-MA15248 100 ug
EUR 363
Description: Mouse monoclonal to RPL32

Anti-RPL32 (1B11)

YF-MA15249 100 ug
EUR 363
Description: Mouse monoclonal to RPL32

RPL32 Polyclonal Conjugated Antibody

C27860 100ul
EUR 397

Rat RPL32 shRNA Plasmid

20-abx985300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL32 ELISA KIT|Human

EF002590 96 Tests
EUR 689

Human RPL32 shRNA Plasmid

20-abx954146
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL32 shRNA Plasmid

20-abx972497
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL32 Recombinant Protein (Human)

RP026968 100 ug Ask for price

RPL32 Recombinant Protein (Rat)

RP226670 100 ug Ask for price

RPL32 Recombinant Protein (Mouse)

RP169043 100 ug Ask for price

Ribosomal Protein L32 (RPL32) Antibody

20-abx115241
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L32 (RPL32) Antibody

abx146441-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L32 (RPL32) Antibody

abx237433-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL32 ORF Vector (Human) (pORF)

ORF008990 1.0 ug DNA
EUR 95

Rpl32 ORF Vector (Mouse) (pORF)

ORF056349 1.0 ug DNA
EUR 506

Rpl32 ORF Vector (Rat) (pORF)

ORF075558 1.0 ug DNA
EUR 506

RPL32 sgRNA CRISPR Lentivector set (Human)

K1966501 3 x 1.0 ug
EUR 339

Rpl32 sgRNA CRISPR Lentivector set (Mouse)

K4399201 3 x 1.0 ug
EUR 339

Rpl32 sgRNA CRISPR Lentivector set (Rat)

K6800501 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L32 (RPL32) ELISA Kit

abx382917-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPL32 sgRNA CRISPR Lentivector (Human) (Target 1)

K1966502 1.0 ug DNA
EUR 154

RPL32 sgRNA CRISPR Lentivector (Human) (Target 2)

K1966503 1.0 ug DNA
EUR 154

RPL32 sgRNA CRISPR Lentivector (Human) (Target 3)

K1966504 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4399202 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4399203 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4399204 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6800502 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6800503 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6800504 1.0 ug DNA
EUR 154

RPL32 Protein Vector (Human) (pPB-C-His)

PV035957 500 ng
EUR 329

RPL32 Protein Vector (Human) (pPB-N-His)

PV035958 500 ng
EUR 329

RPL32 Protein Vector (Human) (pPM-C-HA)

PV035959 500 ng
EUR 329

RPL32 Protein Vector (Human) (pPM-C-His)

PV035960 500 ng
EUR 329

RPL32 Protein Vector (Rat) (pPB-C-His)

PV302230 500 ng
EUR 603

RPL32 Protein Vector (Rat) (pPB-N-His)

PV302231 500 ng
EUR 603

RPL32 Protein Vector (Rat) (pPM-C-HA)

PV302232 500 ng
EUR 603

RPL32 Protein Vector (Rat) (pPM-C-His)

PV302233 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPB-C-His)

PV225394 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPB-N-His)

PV225395 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPM-C-HA)

PV225396 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPM-C-His)

PV225397 500 ng
EUR 603

Rpl32 3'UTR GFP Stable Cell Line

TU168096 1.0 ml Ask for price

RPL32 3'UTR Luciferase Stable Cell Line

TU021344 1.0 ml
EUR 1521

Rpl32 3'UTR Luciferase Stable Cell Line

TU118096 1.0 ml Ask for price

RPL32 3'UTR GFP Stable Cell Line

TU071344 1.0 ml
EUR 1521

Rpl32 3'UTR Luciferase Stable Cell Line

TU219639 1.0 ml Ask for price

Rpl32 3'UTR GFP Stable Cell Line

TU269639 1.0 ml Ask for price

Rat 60S ribosomal protein L32(RPL32) ELISA kit

E02R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L32(RPL32) ELISA kit

E02R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L32(RPL32) ELISA kit

E02R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit

E03R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit

E03R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit

E03R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit

E04R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit

E04R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit

E04R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit

E01R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit

E01R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit

E01R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit

E06R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit

E06R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit

E06R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit

E07R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit

E07R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit

E07R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L32(RPL32) ELISA kit

E08R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L32(RPL32) ELISA kit

E08R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.