RPL32 antibody
70R-19980	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL32 antibody

RPL32 antibody
70R-1471	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RPL32 antibody raised against the N terminal of RPL32

RPL32 siRNA
20-abx931958	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL32 siRNA
20-abx931959	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL32 Antibody
1-CSB-PA020237GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL32. Recognizes RPL32 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-RPL32
YF-PA24610	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPL32

RPL32 cloning plasmid
CSB-CL020237HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 408 Sequence: atggccgccctcagaccccttgtgaagcccaagatcgtcaaaaagagaaccaagaagttcatccggcaccagtcagaccgatatgtcaaaattaagcgtaactggcggaaacccagaggcattgacaacagggttcgtagaagattcaagggccagatcttgatgcccaacattgg Show more
Description: A cloning plasmid for the RPL32 gene.

anti- RPL32 antibody
FNab07433	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L32 Uniprot ID: P62910 Gene ID: 6161 Research Area: Metabolism
Description: Antibody raised against RPL32

RPL32 Rabbit pAb
A13001-100ul	Abclonal	100 ul	EUR 308

RPL32 Rabbit pAb
A13001-200ul	Abclonal	200 ul	EUR 459

RPL32 Rabbit pAb
A13001-20ul	Abclonal	20 ul	EUR 183

RPL32 Rabbit pAb
A13001-50ul	Abclonal	50 ul	EUR 223

RPL32 Blocking Peptide
33R-1035	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM166 antibody, catalog no. 70R-9643

RPL32 Polyclonal Antibody
27860-100ul	SAB	100ul	EUR 252

RPL32 Polyclonal Antibody
27860-50ul	SAB	50ul	EUR 187

Anti-RPL32 antibody
PAab07433	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-RPL32
PVT13699	Lifescience Market	2 ug	EUR 391

Anti-RPL32 antibody
STJ114970	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. It is located in the cytoplasm. Although some studies have mapped this gene to 3q13.3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for this gene.

Anti-RPL32 (1C3)
YF-MA15248	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPL32

Anti-RPL32 (1B11)
YF-MA15249	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPL32

RPL32 Polyclonal Conjugated Antibody
C27860	SAB	100ul	EUR 397

Rat RPL32 shRNA Plasmid
20-abx985300	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL32 ELISA KIT|Human
EF002590	Lifescience Market	96 Tests	EUR 689

Human RPL32 shRNA Plasmid
20-abx954146	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RPL32 shRNA Plasmid
20-abx972497	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL32 Recombinant Protein (Human)
RP026968	ABM	100 ug	Ask for price

RPL32 Recombinant Protein (Rat)
RP226670	ABM	100 ug	Ask for price

RPL32 Recombinant Protein (Mouse)
RP169043	ABM	100 ug	Ask for price

Ribosomal Protein L32 (RPL32) Antibody
20-abx115241	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L32 (RPL32) Antibody
abx146441-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ribosomal Protein L32 (RPL32) Antibody
abx237433-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RPL32 ORF Vector (Human) (pORF)
ORF008990	ABM	1.0 ug DNA	EUR 95

Rpl32 ORF Vector (Mouse) (pORF)
ORF056349	ABM	1.0 ug DNA	EUR 506

Rpl32 ORF Vector (Rat) (pORF)
ORF075558	ABM	1.0 ug DNA	EUR 506

RPL32 sgRNA CRISPR Lentivector set (Human)
K1966501	ABM	3 x 1.0 ug	EUR 339

Rpl32 sgRNA CRISPR Lentivector set (Mouse)
K4399201	ABM	3 x 1.0 ug	EUR 339

Rpl32 sgRNA CRISPR Lentivector set (Rat)
K6800501	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein L32 (RPL32) ELISA Kit
abx382917-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

RPL32 sgRNA CRISPR Lentivector (Human) (Target 1)
K1966502	ABM	1.0 ug DNA	EUR 154

RPL32 sgRNA CRISPR Lentivector (Human) (Target 2)
K1966503	ABM	1.0 ug DNA	EUR 154

RPL32 sgRNA CRISPR Lentivector (Human) (Target 3)
K1966504	ABM	1.0 ug DNA	EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4399202	ABM	1.0 ug DNA	EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4399203	ABM	1.0 ug DNA	EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4399204	ABM	1.0 ug DNA	EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6800502	ABM	1.0 ug DNA	EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6800503	ABM	1.0 ug DNA	EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6800504	ABM	1.0 ug DNA	EUR 154

RPL32 Protein Vector (Human) (pPB-C-His)
PV035957	ABM	500 ng	EUR 329

RPL32 Protein Vector (Human) (pPB-N-His)
PV035958	ABM	500 ng	EUR 329

RPL32 Protein Vector (Human) (pPM-C-HA)
PV035959	ABM	500 ng	EUR 329

RPL32 Protein Vector (Human) (pPM-C-His)
PV035960	ABM	500 ng	EUR 329

RPL32 Protein Vector (Rat) (pPB-C-His)
PV302230	ABM	500 ng	EUR 603

RPL32 Protein Vector (Rat) (pPB-N-His)
PV302231	ABM	500 ng	EUR 603

RPL32 Protein Vector (Rat) (pPM-C-HA)
PV302232	ABM	500 ng	EUR 603

RPL32 Protein Vector (Rat) (pPM-C-His)
PV302233	ABM	500 ng	EUR 603

RPL32 Protein Vector (Mouse) (pPB-C-His)
PV225394	ABM	500 ng	EUR 603

RPL32 Protein Vector (Mouse) (pPB-N-His)
PV225395	ABM	500 ng	EUR 603

RPL32 Protein Vector (Mouse) (pPM-C-HA)
PV225396	ABM	500 ng	EUR 603

RPL32 Protein Vector (Mouse) (pPM-C-His)
PV225397	ABM	500 ng	EUR 603

Rpl32 3'UTR GFP Stable Cell Line
TU168096	ABM	1.0 ml	Ask for price

RPL32 3'UTR Luciferase Stable Cell Line
TU021344	ABM	1.0 ml	EUR 1521

Rpl32 3'UTR Luciferase Stable Cell Line
TU118096	ABM	1.0 ml	Ask for price

RPL32 3'UTR GFP Stable Cell Line
TU071344	ABM	1.0 ml	EUR 1521

Rpl32 3'UTR Luciferase Stable Cell Line
TU219639	ABM	1.0 ml	Ask for price

Rpl32 3'UTR GFP Stable Cell Line
TU269639	ABM	1.0 ml	Ask for price

Rat 60S ribosomal protein L32(RPL32) ELISA kit
E02R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L32(RPL32) ELISA kit
E02R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L32(RPL32) ELISA kit
E02R0454-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit
E03R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit
E03R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit
E03R0454-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit
E04R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit
E04R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit
E04R0454-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit
E01R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit
E01R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit
E01R0454-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit
E06R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit
E06R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit
E06R0454-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit
E07R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit
E07R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit
E07R0454-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L32(RPL32) ELISA kit
E08R0454-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L32(RPL32) ELISA kit
E08R0454-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.