EXOC6

EXOC6 siRNA

20-abx915808
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC6 siRNA

20-abx915809
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC6 antibody

70R-3769 50 ug
EUR 467
Description: Rabbit polyclonal EXOC6 antibody raised against the N terminal of EXOC6

EXOC6 antibody

70R-3876 50 ug
EUR 467
Description: Rabbit polyclonal EXOC6 antibody raised against the middle region of EXOC6

EXOC6 antibody

70R-17170 50 ul
EUR 435
Description: Rabbit polyclonal EXOC6 antibody

EXOC6 Antibody

DF12989 200ul
EUR 304
Description: EXOC6 Antibody detects endogenous levels of EXOC6.

EXOC6 Antibody

1-CSB-PA007884GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC6. Recognizes EXOC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EXOC6 cloning plasmid

CSB-CL007884HU-10ug 10ug
EUR 786
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2415
  • Sequence: atggcggagaacagcgagagtctgggcaccgtccccgagcacgagcggatcttgcaggagatcgagagcaccgacaccgcctgtgtggggcccaccctccggtctgtgtatgatgaccaaccaaatgcgcacaagaagtttatggaaaagttagatgcttgtatccgtaatcatg
  • Show more
Description: A cloning plasmid for the EXOC6 gene.

anti- EXOC6 antibody

FNab02895 100µg
EUR 505.25
  • Immunogen: exocyst complex component 6
  • Uniprot ID: Q8TAG9
  • Gene ID: 54536
  • Research Area: Signal Transduction
Description: Antibody raised against EXOC6

EXOC6 Blocking Peptide

33R-6184 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC6 antibody, catalog no. 70R-3769

EXOC6 Blocking Peptide

33R-10220 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC6 antibody, catalog no. 70R-3876

EXOC6 Blocking Peptide

DF12989-BP 1mg
EUR 195

Anti-EXOC6 antibody

PAab02895 100 ug
EUR 355

Rat EXOC6 shRNA Plasmid

20-abx985723
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC6 ELISA KIT|Human

EF009474 96 Tests
EUR 689

Canine EXOC6 ELISA KIT

ELI-32740d 96 Tests
EUR 928

Human EXOC6 shRNA Plasmid

20-abx960118
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC6 Recombinant Protein (Human)

RP011047 100 ug Ask for price

EXOC6 Recombinant Protein (Rat)

RP200096 100 ug Ask for price

EXOC6 Recombinant Protein (Mouse)

RP132482 100 ug Ask for price

Polyclonal EXOC6 antibody - middle region

APR15893G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXOC6 - middle region. This antibody is tested and proven to work in the following applications:

EXOC6 ORF Vector (Human) (pORF)

ORF003683 1.0 ug DNA
EUR 95

Exoc6 ORF Vector (Rat) (pORF)

ORF066700 1.0 ug DNA
EUR 506

Exoc6 ORF Vector (Mouse) (pORF)

ORF044162 1.0 ug DNA
EUR 506

Exocyst Complex Component 6 (EXOC6) Antibody

20-abx112406
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 6 (EXOC6) Antibody

abx232895-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Exoc6 sgRNA CRISPR Lentivector set (Mouse)

K3427901 3 x 1.0 ug
EUR 339

EXOC6 sgRNA CRISPR Lentivector set (Human)

K0702801 3 x 1.0 ug
EUR 339

Exoc6 sgRNA CRISPR Lentivector set (Rat)

K6843701 3 x 1.0 ug
EUR 339

Exoc6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3427902 1.0 ug DNA
EUR 154

Exoc6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3427903 1.0 ug DNA
EUR 154

Exoc6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3427904 1.0 ug DNA
EUR 154

EXOC6 sgRNA CRISPR Lentivector (Human) (Target 1)

K0702802 1.0 ug DNA
EUR 154

EXOC6 sgRNA CRISPR Lentivector (Human) (Target 2)

K0702803 1.0 ug DNA
EUR 154

EXOC6 sgRNA CRISPR Lentivector (Human) (Target 3)

K0702804 1.0 ug DNA
EUR 154

Exoc6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6843702 1.0 ug DNA
EUR 154

Exoc6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6843703 1.0 ug DNA
EUR 154

Exoc6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6843704 1.0 ug DNA
EUR 154

EXOC6 Protein Vector (Mouse) (pPB-C-His)

PV176646 500 ng
EUR 1065

EXOC6 Protein Vector (Mouse) (pPB-N-His)

PV176647 500 ng
EUR 1065

EXOC6 Protein Vector (Mouse) (pPM-C-HA)

PV176648 500 ng
EUR 1065

EXOC6 Protein Vector (Mouse) (pPM-C-His)

PV176649 500 ng
EUR 1065

EXOC6 Protein Vector (Human) (pPB-C-His)

PV014729 500 ng
EUR 329

EXOC6 Protein Vector (Human) (pPB-N-His)

PV014730 500 ng
EUR 329

EXOC6 Protein Vector (Human) (pPM-C-HA)

PV014731 500 ng
EUR 329

EXOC6 Protein Vector (Human) (pPM-C-His)

PV014732 500 ng
EUR 329

EXOC6 Protein Vector (Rat) (pPB-C-His)

PV266798 500 ng
EUR 1166

EXOC6 Protein Vector (Rat) (pPB-N-His)

PV266799 500 ng
EUR 1166

EXOC6 Protein Vector (Rat) (pPM-C-HA)

PV266800 500 ng
EUR 1166

EXOC6 Protein Vector (Rat) (pPM-C-His)

PV266801 500 ng
EUR 1166

Exoc6 3'UTR Luciferase Stable Cell Line

TU204153 1.0 ml Ask for price

Exoc6 3'UTR GFP Stable Cell Line

TU156011 1.0 ml Ask for price

EXOC6 3'UTR Luciferase Stable Cell Line

TU007124 1.0 ml
EUR 1521

Exoc6 3'UTR Luciferase Stable Cell Line

TU106011 1.0 ml Ask for price

EXOC6 3'UTR GFP Stable Cell Line

TU057124 1.0 ml
EUR 1521

Exoc6 3'UTR GFP Stable Cell Line

TU254153 1.0 ml Ask for price

Mouse Exocyst complex component 6, Exoc6 ELISA KIT

ELI-09968m 96 Tests
EUR 865

Human Exocyst complex component 6, EXOC6 ELISA KIT

ELI-47671h 96 Tests
EUR 824

Human Exocyst Complex Component 6 (EXOC6) ELISA Kit

abx387216-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EXOC6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV681325 1.0 ug DNA
EUR 1355

EXOC6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV681329 1.0 ug DNA
EUR 1355

EXOC6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV681330 1.0 ug DNA
EUR 1355

Exoc6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3427905 3 x 1.0 ug
EUR 376

EXOC6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0702805 3 x 1.0 ug
EUR 376

Exoc6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6843705 3 x 1.0 ug
EUR 376

Exoc6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3427906 1.0 ug DNA
EUR 167

Exoc6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3427907 1.0 ug DNA
EUR 167

Exoc6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3427908 1.0 ug DNA
EUR 167

EXOC6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0702806 1.0 ug DNA
EUR 167

EXOC6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0702807 1.0 ug DNA
EUR 167