PSMD14 Antibody

31120-50ul 50ul
EUR 187

PSMD14 antibody

70R-19600 50 ul
EUR 435
Description: Rabbit polyclonal PSMD14 antibody

PSMD14 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PSMD14 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PSMD14 Antibody

DF8011 200ul
EUR 304
Description: PSMD14 Antibody detects endogenous levels of total PSMD14.

PSMD14 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMD14 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD14 Antibody

ABD8011 100 ug
EUR 438

PSMD14 Antibody

ABD8036 100 ug
EUR 438


YF-PA16792 50 ul
EUR 363
Description: Mouse polyclonal to PSMD14


YF-PA16793 50 ug
EUR 363
Description: Mouse polyclonal to PSMD14


YF-PA25513 50 ul
EUR 334
Description: Mouse polyclonal to PSMD14

PSMD14 Rabbit pAb

A10782-100ul 100 ul
EUR 308

PSMD14 Rabbit pAb

A10782-200ul 200 ul
EUR 459

PSMD14 Rabbit pAb

A10782-20ul 20 ul
EUR 183

PSMD14 Rabbit pAb

A10782-50ul 50 ul
EUR 223

PSMD14 Blocking Peptide

DF8011-BP 1mg
EUR 195

PSMD14 Conjugated Antibody

C31120 100ul
EUR 397

PSMD14 cloning plasmid

CSB-CL018904HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atgttgctaaatttgcataagaagagttggatggaaggtttgacacttcaggactacagtgaacattgtaaacacaatgaatcagtggtaaaagagatgttggaattagccaagaattacaataaggctgtagaagaagaagataagatgacacctgaacagctggcaataaagaa
  • Show more
Description: A cloning plasmid for the PSMD14 gene.

PSMD14 cloning plasmid

CSB-CL018904HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atggacagacttcttagacttggaggaggtatgcctggactgggccaggggccacctacagatgctcctgcagtggacacagcagaacaagtctatatctcttccctggcactgttaaaaatgttaaaacatggccgtgctggagttccaatggaagttatgggtttgatgcttgg
  • Show more
Description: A cloning plasmid for the PSMD14 gene.

anti- PSMD14 antibody

FNab06886 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: proteasome(prosome, macropain) 26S subunit, non-ATPase, 14
  • Uniprot ID: O00487
  • Gene ID: 10213
  • Research Area: Metabolism
Description: Antibody raised against PSMD14

Anti-PSMD14 antibody

PAab06886 100 ug
EUR 412


PVT13244 2 ug
EUR 391

Anti-PSMD14 antibody

STJ112678 100 µl
EUR 277
Description: This gene encodes a component of the 26S proteasome. The 26S proteasome is a large multiprotein complex that catalyzes the degradation of ubiquitinated intracellular proteins. The encoded protein is a component of the 19S regulatory cap complex of the 26S proteasome and mediates substrate deubiquitination. A pseudogene of this gene is also located on the long arm of chromosome 2.


ELI-30564h 96 Tests
EUR 824


EF002129 96 Tests
EUR 689

Mouse Psmd14 ELISA KIT

ELI-52405m 96 Tests
EUR 865

Mouse PSMD14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD14 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMD14 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMD14 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against PSMD14. Recognizes PSMD14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMD14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD14 Recombinant Protein (Human)

RP024982 100 ug Ask for price

PSMD14 Recombinant Protein (Human)

RP024985 100 ug Ask for price

PSMD14 Recombinant Protein (Mouse)

RP165332 100 ug Ask for price

PSMD14 Recombinant Protein (Rat)

RP222671 100 ug Ask for price

Anti-PSMD14 (4A10-E8)

YF-MA17193 100 ug
EUR 363
Description: Mouse monoclonal to PSMD14

Polyclonal PSMD14 Antibody (C-term)

APR04410G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD14 (C-term). This antibody is tested and proven to work in the following applications:

Psmd14 ORF Vector (Rat) (pORF)

ORF074225 1.0 ug DNA
EUR 506

PSMD14 ORF Vector (Human) (pORF)

ORF008328 1.0 ug DNA
EUR 95

PSMD14 ORF Vector (Human) (pORF)

ORF008329 1.0 ug DNA
EUR 95

Psmd14 ORF Vector (Mouse) (pORF)

ORF055112 1.0 ug DNA
EUR 506

Psmd14 sgRNA CRISPR Lentivector set (Mouse)

K4926501 3 x 1.0 ug
EUR 339

Psmd14 sgRNA CRISPR Lentivector set (Rat)

K7188001 3 x 1.0 ug
EUR 339

PSMD14 sgRNA CRISPR Lentivector set (Human)

K1743901 3 x 1.0 ug
EUR 339

Psmd14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4926502 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4926503 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4926504 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7188002 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7188003 1.0 ug DNA
EUR 154

Psmd14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7188004 1.0 ug DNA
EUR 154

PSMD14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1743902 1.0 ug DNA
EUR 154

PSMD14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1743903 1.0 ug DNA
EUR 154