mog

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Hu-96T 96T
EUR 621
  • Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-48T 48T
EUR 508
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-96T 96T
EUR 661
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-48Tests 48 Tests
EUR 478

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-96Tests 96 Tests
EUR 662

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-48Tests 48 Tests
EUR 511

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-96Tests 96 Tests
EUR 709

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-48Tests 48 Tests
EUR 500

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-96Tests 96 Tests
EUR 692

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-48Tests 48 Tests
EUR 534

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-96Tests 96 Tests
EUR 742

Mouse Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-230-MOG 1 Kit
EUR 773

Rat Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-240-MOG 1 Kit
EUR 773

MOG

GT15141 100 ug
EUR 526

MOG/ Rat MOG ELISA Kit

ELA-E0421r 96 Tests
EUR 886

MOG siRNA

20-abx924385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOG siRNA

20-abx924386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOG Antibody

ABD7294 100 ug
EUR 438

MOG Antibody

32793-100ul 100ul
EUR 252

MOG antibody

70R-18564 50 ul
EUR 435
Description: Rabbit polyclonal MOG antibody

MOG Antibody

DF7294 200ul
EUR 304
Description: MOG Antibody detects endogenous levels of total MOG.

MOG Antibody

1-CSB-PA619083ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MOG Antibody

1-CSB-PA014709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal MOG Antibody

AMM06419G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG . This antibody is tested and proven to work in the following applications:

MOG Conjugated Antibody

C32793 100ul
EUR 397

anti- MOG antibody

FNab05267 100µg
EUR 505.25
  • Immunogen: myelin oligodendrocyte glycoprotein
  • Uniprot ID: Q16653
  • Gene ID: 4340
  • Research Area: Neuroscience, Stem Cells, Immunology
Description: Antibody raised against MOG

MOG Polyclonal Antibody

ES9838-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOG Polyclonal Antibody

ES9838-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOG Polyclonal Antibody

ABP59304-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Polyclonal Antibody

ABP59304-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Polyclonal Antibody

ABP59304-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Rabbit pAb

A5353-100ul 100 ul
EUR 308

MOG Rabbit pAb

A5353-200ul 200 ul
EUR 459

MOG Rabbit pAb

A5353-20ul 20 ul
EUR 183

MOG Rabbit pAb

A5353-50ul 50 ul
EUR 223

MOG (35-55)

A8306-1 1 mg
EUR 163
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG (35-55)

A8306-5 5 mg
EUR 390
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG Blocking Peptide

DF7294-BP 1mg
EUR 195

MOG cloning plasmid

CSB-CL619083HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggcaagcttatcgagaccctctctgcccagctgcctctgctccttcctcctcctcctcctcctccaagtgtcttccagctatgcagggcagttcagagtgataggaccaagacaccctatccgggctctggtcggggatgaagtggaattgccatgtcgcatatctcctgggaa
  • Show more
Description: A cloning plasmid for the MOG gene.

Anti-MOG antibody

PAab05267 100 ug
EUR 355

pBluescriptR-MOG Plasmid

PVT17024 2 ug
EUR 325

Anti-MOG antibody

STJ70668 100 µg
EUR 359

Anti-MOG antibody

STJ27306 100 µl
EUR 277
Description: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-MOG antibody

STJ190996 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOG

Polyclonal MOG Antibody (Center)

AMM06421G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (Center). This antibody is tested and proven to work in the following applications:

Human MOG ELISA Kit

ELA-E0421h 96 Tests
EUR 824

MOG ELISA KIT|Human

EF000609 96 Tests
EUR 689

Human MOG shRNA Plasmid

20-abx952949
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MOG shRNA Plasmid

20-abx971548
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOG Recombinant Protein (Human)

RP019705 100 ug Ask for price

MOG Recombinant Protein (Rat)

RP212048 100 ug Ask for price

MOG Recombinant Protein (Mouse)

RP151097 100 ug Ask for price

Polyclonal Goat Anti-MOG Antibody

AMM05945G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MOG . This antibody is tested and proven to work in the following applications:

Polyclonal MOG Antibody (aa163-174)

AMM06420G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (aa163-174). This antibody is tested and proven to work in the following applications:

Human Anti-MOG ELISA Kit

EHA0478 96Tests
EUR 521

Goat Anti-MOG ELISA Kit

EGTA0478 96Tests
EUR 521

Canine Anti-MOG ELISA Kit

ECA0478 96Tests
EUR 521

Chicken Anti-MOG ELISA Kit

ECKA0478 96Tests
EUR 521

Bovine Anti-MOG ELISA Kit

EBA0478 96Tests
EUR 521

Anserini Anti-MOG ELISA Kit

EAA0478 96Tests
EUR 521

Human Anti- MOG ELISA kit

ELA-E9412h 96 Tests
EUR 824

Rat Anti-MOG ELISA Kit

ERA0478 96Tests
EUR 521

Rabbit Anti-MOG ELISA Kit

ERTA0478 96Tests
EUR 521

Sheep Anti-MOG ELISA Kit

ESA0478 96Tests
EUR 521

Porcine Anti-MOG ELISA Kit

EPA0478 96Tests
EUR 521

Monkey Anti-MOG ELISA Kit

EMKA0478 96Tests
EUR 521

Mouse Anti-MOG ELISA Kit

EMA0478 96Tests
EUR 521

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx113907
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx137143
  • EUR 467.00
  • EUR 648.00
  • 0.5 mg
  • 1 mg
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103636
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103637
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103638
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103639
  • EUR 467.00
  • EUR 133.00
  • EUR 1372.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx104849
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx004094
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx030041-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx030041-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx173648
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx173649
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx320586
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx260391
  • EUR 230.00
  • EUR 1970.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx432979-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx235267-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MOG ORF Vector (Human) (pORF)

ORF006569 1.0 ug DNA
EUR 95

Mog ORF Vector (Mouse) (pORF)

ORF050367 1.0 ug DNA
EUR 506

Mog ORF Vector (Rat) (pORF)

ORF070684 1.0 ug DNA
EUR 506

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Bo01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55803
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0KDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16653
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.5kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Mu01
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63345
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

MOG ELISA Kit (Rat) (OKCD00239)

OKCD00239 96 Wells
EUR 818
Description: Description of target: Mediates homophilic cell-cell adhesion (By similarity). Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

MOG ELISA Kit (Human) (OKAN05640)

OKAN05640 96 Wells
EUR 792
Description: Description of target: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

MOG ELISA Kit (Human) (OKCD06330)

OKCD06330 96 Wells
EUR 753
Description: Description of target: MOG is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. MOG is involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified Minor component of the myelin sheath is involved in completion and/or maintenance of the myelin sheath and in cell- cell communication.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

MOG ELISA Kit (Mouse) (OKCA02412)

OKCA02412 96 Wells
EUR 846
Description: Description of target: Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL

MOG ELISA Kit (Mouse) (OKEH05829)

OKEH05829 96 Wells
EUR 766
Description: Description of target: Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL