B3GNTL1

B3GNTL1 siRNA

20-abx900572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNTL1 siRNA

20-abx908792
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNTL1 siRNA

20-abx908793
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNTL1 cloning plasmid

CSB-CL734577HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: ATGCCGTCTATGTTGGTTGTGAACGTGCATTTGGCACCTGGCAGGGCCAACCCTCATGGCGTGTGCGTGAACACATCCCTAAACCATAGTCTAATTTATCCTATTTTTGTAGTTCATGTGAGCAGAATCCAGTGTCTGTGTTCTCGCATCTGGTTTTCACTCCACGTGTTTGGGGT
  • Show more
Description: A cloning plasmid for the B3GNTL1 gene.

Mouse B3gntl1 ELISA KIT

ELI-23966m 96 Tests
EUR 865

Rat B3GNTL1 shRNA Plasmid

20-abx990693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human B3GNTL1 shRNA Plasmid

20-abx965483
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse B3GNTL1 shRNA Plasmid

20-abx980641
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human B3GNTL1 ELISA KIT

ELI-49993h 96 Tests
EUR 824

B3GNTL1 Recombinant Protein (Human)

RP036889 100 ug Ask for price

B3GNTL1 Recombinant Protein (Mouse)

RP118544 100 ug Ask for price

B3GNTL1 Recombinant Protein (Rat)

RP191756 100 ug Ask for price

B3gntl1 ORF Vector (Rat) (pORF)

ORF063920 1.0 ug DNA
EUR 506

B3GNTL1 ORF Vector (Human) (pORF)

ORF012297 1.0 ug DNA
EUR 354

B3gntl1 ORF Vector (Mouse) (pORF)

ORF039516 1.0 ug DNA
EUR 506

B3gntl1 sgRNA CRISPR Lentivector set (Mouse)

K4912101 3 x 1.0 ug
EUR 339

B3gntl1 sgRNA CRISPR Lentivector set (Rat)

K7253701 3 x 1.0 ug
EUR 339

B3GNTL1 sgRNA CRISPR Lentivector set (Human)

K0164601 3 x 1.0 ug
EUR 339

B3gntl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4912102 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4912103 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4912104 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7253702 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7253703 1.0 ug DNA
EUR 154

B3gntl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7253704 1.0 ug DNA
EUR 154

B3GNTL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0164602 1.0 ug DNA
EUR 154

B3GNTL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0164603 1.0 ug DNA
EUR 154

B3GNTL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0164604 1.0 ug DNA
EUR 154

B3GNTL1 Protein Vector (Mouse) (pPB-C-His)

PV158062 500 ng
EUR 603

B3GNTL1 Protein Vector (Mouse) (pPB-N-His)

PV158063 500 ng
EUR 603

B3GNTL1 Protein Vector (Mouse) (pPM-C-HA)

PV158064 500 ng
EUR 603

B3GNTL1 Protein Vector (Mouse) (pPM-C-His)

PV158065 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPB-C-His)

PV255678 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPB-N-His)

PV255679 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPM-C-HA)

PV255680 500 ng
EUR 603

B3GNTL1 Protein Vector (Rat) (pPM-C-His)

PV255681 500 ng
EUR 603

B3GNTL1 Protein Vector (Human) (pPB-His-MBP)

PV325978 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPB-His-GST)

PV325979 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPB-C-His)

PV049185 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPB-N-His)

PV049186 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPM-C-HA)

PV049187 500 ng
EUR 481

B3GNTL1 Protein Vector (Human) (pPM-C-His)

PV049188 500 ng
EUR 481

B3gntl1 3'UTR GFP Stable Cell Line

TU152478 1.0 ml Ask for price

B3gntl1 3'UTR Luciferase Stable Cell Line

TU102478 1.0 ml Ask for price

B3gntl1 3'UTR Luciferase Stable Cell Line

TU201186 1.0 ml Ask for price

B3gntl1 3'UTR GFP Stable Cell Line

TU251186 1.0 ml Ask for price

B3GNTL1 3'UTR GFP Stable Cell Line

TU051585 1.0 ml
EUR 1394

B3GNTL1 3'UTR Luciferase Stable Cell Line

TU001585 1.0 ml
EUR 1394

B3GNTL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV630679 1.0 ug DNA
EUR 682

B3GNTL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV630683 1.0 ug DNA
EUR 682

B3GNTL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV630684 1.0 ug DNA
EUR 682