mog

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Hu-96T 96T
EUR 621
  • Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-48T 48T
EUR 508
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-96T 96T
EUR 661
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-48Tests 48 Tests
EUR 500

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-96Tests 96 Tests
EUR 692

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-48Tests 48 Tests
EUR 534

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-96Tests 96 Tests
EUR 742

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-48Tests 48 Tests
EUR 478

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-96Tests 96 Tests
EUR 662

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-48Tests 48 Tests
EUR 511

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-96Tests 96 Tests
EUR 709

Mouse Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-230-MOG 1 Kit
EUR 773

Rat Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-240-MOG 1 Kit
EUR 773

MOG

GT15141 100 ug
EUR 526

MOG/ Rat MOG ELISA Kit

ELA-E0421r 96 Tests
EUR 886

MOG antibody

70R-18564 50 ul
EUR 435
Description: Rabbit polyclonal MOG antibody

MOG Antibody

32793-100ul 100ul
EUR 252

MOG Antibody

1-CSB-PA619083ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MOG Antibody

DF7294 200ul
EUR 304
Description: MOG Antibody detects endogenous levels of total MOG.

MOG Antibody

1-CSB-PA014709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MOG siRNA

20-abx924385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOG siRNA

20-abx924386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOG Antibody

ABD7294 100 ug
EUR 438

MOG Blocking Peptide

DF7294-BP 1mg
EUR 195

MOG Conjugated Antibody

C32793 100ul
EUR 397

MOG cloning plasmid

CSB-CL619083HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggcaagcttatcgagaccctctctgcccagctgcctctgctccttcctcctcctcctcctcctccaagtgtcttccagctatgcagggcagttcagagtgataggaccaagacaccctatccgggctctggtcggggatgaagtggaattgccatgtcgcatatctcctgggaa
  • Show more
Description: A cloning plasmid for the MOG gene.

Polyclonal MOG Antibody

AMM06419G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG . This antibody is tested and proven to work in the following applications:

MOG (35-55)

A8306-1 1 mg
EUR 163
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG (35-55)

A8306-5 5 mg
EUR 390
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG Rabbit pAb

A5353-100ul 100 ul
EUR 308

MOG Rabbit pAb

A5353-200ul 200 ul
EUR 459

MOG Rabbit pAb

A5353-20ul 20 ul
EUR 183

MOG Rabbit pAb

A5353-50ul 50 ul
EUR 223

MOG Polyclonal Antibody

ABP59304-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Polyclonal Antibody

ABP59304-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Polyclonal Antibody

ABP59304-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Polyclonal Antibody

ES9838-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOG Polyclonal Antibody

ES9838-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- MOG antibody

FNab05267 100µg
EUR 505.25
  • Immunogen: myelin oligodendrocyte glycoprotein
  • Uniprot ID: Q16653
  • Gene ID: 4340
  • Research Area: Neuroscience, Stem Cells, Immunology
Description: Antibody raised against MOG

Anti-MOG antibody

PAab05267 100 ug
EUR 355

pBluescriptR-MOG Plasmid

PVT17024 2 ug
EUR 325

Anti-MOG antibody

STJ27306 100 µl
EUR 277
Description: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-MOG antibody

STJ70668 100 µg
EUR 359

Anti-MOG antibody

STJ190996 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOG

Human MOG ELISA Kit

ELA-E0421h 96 Tests
EUR 824

MOG ELISA KIT|Human

EF000609 96 Tests
EUR 689

Polyclonal MOG Antibody (Center)

AMM06421G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (Center). This antibody is tested and proven to work in the following applications:

Human MOG shRNA Plasmid

20-abx952949
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MOG shRNA Plasmid

20-abx971548
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOG Recombinant Protein (Human)

RP019705 100 ug Ask for price

MOG Recombinant Protein (Mouse)

RP151097 100 ug Ask for price

MOG Recombinant Protein (Rat)

RP212048 100 ug Ask for price

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx004094
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103636
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103637
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103638
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103639
  • EUR 467.00
  • EUR 133.00
  • EUR 1372.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx104849
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx113907
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx137143
  • EUR 467.00
  • EUR 648.00
  • 0.5 mg
  • 1 mg
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx173648
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx173649
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx030041-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx030041-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx260391
  • EUR 230.00
  • EUR 1970.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Human Anti-MOG ELISA Kit

EHA0478 96Tests
EUR 521

Goat Anti-MOG ELISA Kit

EGTA0478 96Tests
EUR 521

Canine Anti-MOG ELISA Kit

ECA0478 96Tests
EUR 521

Chicken Anti-MOG ELISA Kit

ECKA0478 96Tests
EUR 521

Anserini Anti-MOG ELISA Kit

EAA0478 96Tests
EUR 521

Bovine Anti-MOG ELISA Kit

EBA0478 96Tests
EUR 521

Human Anti- MOG ELISA kit

ELA-E9412h 96 Tests
EUR 824

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx320586
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx235267-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx432979-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Polyclonal Goat Anti-MOG Antibody

AMM05945G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MOG . This antibody is tested and proven to work in the following applications:

Polyclonal MOG Antibody (aa163-174)

AMM06420G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (aa163-174). This antibody is tested and proven to work in the following applications:

Mouse Anti-MOG ELISA Kit

EMA0478 96Tests
EUR 521

Rat Anti-MOG ELISA Kit

ERA0478 96Tests
EUR 521

Sheep Anti-MOG ELISA Kit

ESA0478 96Tests
EUR 521

Rabbit Anti-MOG ELISA Kit

ERTA0478 96Tests
EUR 521

Monkey Anti-MOG ELISA Kit

EMKA0478 96Tests
EUR 521

Porcine Anti-MOG ELISA Kit

EPA0478 96Tests
EUR 521

Mog ORF Vector (Rat) (pORF)

ORF070684 1.0 ug DNA
EUR 506

MOG ORF Vector (Human) (pORF)

ORF006569 1.0 ug DNA
EUR 95

Mog ORF Vector (Mouse) (pORF)

ORF050367 1.0 ug DNA
EUR 506

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Bo01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55803
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0KDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16653
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.5kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Mu01
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63345
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

MOG ELISA Kit (Human) (OKAN05640)

OKAN05640 96 Wells
EUR 792
Description: Description of target: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

MOG ELISA Kit (Mouse) (OKCA02412)

OKCA02412 96 Wells
EUR 846
Description: Description of target: Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL

MOG ELISA Kit (Rat) (OKCD00239)

OKCD00239 96 Wells
EUR 818
Description: Description of target: Mediates homophilic cell-cell adhesion (By similarity). Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

MOG ELISA Kit (Human) (OKCD06330)

OKCD06330 96 Wells
EUR 753
Description: Description of target: MOG is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. MOG is involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified Minor component of the myelin sheath is involved in completion and/or maintenance of the myelin sheath and in cell- cell communication.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

MOG ELISA Kit (Mouse) (OKEH05829)

OKEH05829 96 Wells
EUR 766
Description: Description of target: Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL

mmps

Rat matrix metalloproteinases,MMPs ELISA kit

E02M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat matrix metalloproteinases,MMPs ELISA kit

E02M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse matrix metalloproteinases,MMPs ELISA kit

E03M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse matrix metalloproteinases,MMPs ELISA kit

E03M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse matrix metalloproteinases,MMPs ELISA kit

E03M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human matrix metalloproteinases,MMPs ELISA kit

E01M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human matrix metalloproteinases,MMPs ELISA kit

E01M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human matrix metalloproteinases,MMPs ELISA kit

E01M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit matrix metalloproteinases,MMPs ELISA kit

E04M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit matrix metalloproteinases,MMPs ELISA kit

E04M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit matrix metalloproteinases,MMPs ELISA kit

E04M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog matrix metalloproteinases,MMPs ELISA kit

E08M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog matrix metalloproteinases,MMPs ELISA kit

E08M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog matrix metalloproteinases,MMPs ELISA kit

E08M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig matrix metalloproteinases,MMPs ELISA kit

E07M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig matrix metalloproteinases,MMPs ELISA kit

E07M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig matrix metalloproteinases,MMPs ELISA kit

E07M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat matrix metalloproteinases,MMPs ELISA kit

E06M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat matrix metalloproteinases,MMPs ELISA kit

E06M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat matrix metalloproteinases,MMPs ELISA kit

E06M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey matrix metalloproteinases,MMPs ELISA kit

E09M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey matrix metalloproteinases,MMPs ELISA kit

E09M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey matrix metalloproteinases,MMPs ELISA kit

E09M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig matrix metalloproteinases,MMPs ELISA kit

E05M0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig matrix metalloproteinases,MMPs ELISA kit

E05M0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig matrix metalloproteinases,MMPs ELISA kit

E05M0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig matrix metalloproteinases,MMPs in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

mip 2

Recombinant Human MIP-4 (CCL18) Protein

PROTP55774-2 10ug
EUR 317
Description: MIP-4 is a CC chemokine that is expressed in lymph nodes, lungs, placenta and bone marrow. MIP-4's primary receptor is unknown. MIP-4 chemoattracts lymphocytes, and has been shown to exert activity on both CD4+ and CD8+ T cells. Recombinant human MIP-4 is a 7.8 kDa protein containing 68 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Human MIP-5 (CCL15) Protein

PROTQ16663-2 25ug
EUR 317
Description: MIP-5 is a CC chemokine that is expressed in the heart, skeletal muscle and adrenal gland. MIP-5 primarily signals through he CCR1 receptor, but also has been found to bind to CCR3. MIP-5 is chemotactic towards T cells and monocytes. Recombinant human MIP-5 is a 10.1 kDa protein containing 92 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

MIP-2/ Rat MIP- 2 ELISA Kit

ELA-E0094r 96 Tests
EUR 886

Recombinant Murine MIP-3 Beta (CCL19) Protein

PROTO70460-2 20ug
EUR 317
Description: MIP-3β is a CC chemokine that is expressed in the thymus, lymph nodes and in activated bone marrow stromal cells and signals through the CCR7 receptor. MIP-3β is a chemoattractant for T and B lymphocytes and myeloid progenitor cells. Human MIP-3β is active on murine cells. Recombinant murine MIP-3β is a 9.2 kDa protein containing 83 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Human MIP-1 Alpha (CCL3) Protein

PROTP10147-2 20ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant human MIP-1α is a 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Murine MIP-1 Alpha (CCL3) Protein

PROTP10855-2 10ug
EUR 317
Description: Both MIP-1 α and MIP-1 β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1 α and MIP-1 β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1 α selectively attracting CD8+ lymphocytes and MIP-1 β selectively attracting CD4+ lymphocytes. Additionally, MIP-1 α and MIP-1 β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1 α and MIP-1 β are active on human and murine hematopoietic cells. Recombinant murine MIP-1 α is a 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Human MIP-3 Alpha (CCL20) Protein

PROTP78556-2 20ug
EUR 317
Description: MIP-3α is a CC chemokine that is expressed in the liver, lymph nodes, appendix, PBL and lung and can signal through the CCR6 receptor. MIP-3α is chemotactic towards lymphocytes and dendritic cells. Additionally, it promotes the adhesion of memory CD4+ T cells and inhibits colony formation of bone marrow myeloid immature progenitors. Recombinant human MIP-3α is an 8.0 kDa protein containing 70 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Human MIP-1 Beta (CCL4) Protein

PROTQ8NHW4-2 10ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant human MIP-1βis a 7.6 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

MIP-2 Antibody

5251-100
EUR 338

MIP-2 Antibody

5253-100
EUR 338

MIP 2 antibody

20R-1790 100 ug
EUR 673
Description: Rabbit polyclonal MIP 2 antibody

Polyclonal MIP-2 Antibody

APR00404G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MIP-2 . This antibody is tested and proven to work in the following applications:

Polyclonal MIP-2 Antibody

APR00405G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MIP-2 . This antibody is tested and proven to work in the following applications:

MIP-2/CXCL2, Mouse

HY-P7258 50ug
EUR 681

MIP-2, Viral Recombinant

P1295-10
EUR 175

MIP-2, Viral Recombinant

P1295-50
EUR 370

MIP-2, CXCL2, viral

RC392-13 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Cytokines

Mip/ Rat Mip ELISA Kit

ELI-23038r 96 Tests
EUR 886

Human MIP-2 ELISA Kit

EHM0018 96Tests
EUR 521

Goat MIP-2 ELISA Kit

EGTM0018 96Tests
EUR 521

Bovine MIP-2 ELISA Kit

EBM0018 96Tests
EUR 521

Chicken MIP-2 ELISA Kit

ECKM0018 96Tests
EUR 521

Canine MIP-2 ELISA Kit

ECM0018 96Tests
EUR 521

Anserini MIP-2 ELISA Kit

EAM0018 96Tests
EUR 521

Porcine MIP-2 ELISA Kit

EPM0018 96Tests
EUR 521

Rat MIP-2 ELISA Kit

ERM0018 96Tests
EUR 521

Rabbit MIP-2 ELISA Kit

ERTM0018 96Tests
EUR 521

Sheep MIP-2 ELISA Kit

ESM0018 96Tests
EUR 521

Monkey MIP-2 ELISA Kit

EMKM0018 96Tests
EUR 521

Mouse MIP-2 ELISA Kit

EMM0018 96Tests
EUR 521

Mouse MIP-2 ELISA kit

LF-EK50669 1×96T
EUR 648

Recombinant Viral MIP-2 Protein

PROTQ98157 50ug
EUR 317
Description: vMIP-2 is a chemokine analog encoded by human herpes virus, and has been shown to have antagonist activity towards several chemokine receptors. Recombinant vMIP-2 is a 7.9 kDa protein consisting of 70 amino acids including the four highly conserved cysteine residues present in CC chemokines.

Anti-CXCL2 / MIP-2 antibody

STJ71916 100 µg
EUR 359

MIP-2, CXCL2, murine (mouse)

RC332-13 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Macrophage Inflammatory Protein 2 (MIP-2) Antibody

abx411719-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

MIP-1

EF000186 96 Tests
EUR 689

MIP-1

EF016651 96 Tests
EUR 689

MIP-3

EF016652 96 Tests
EUR 689

MIP-1

EF016834 96 Tests
EUR 689

MIP-3

EF016984 96 Tests
EUR 689

MIP-1

EF017045 96 Tests
EUR 689

MIP-1

EF017887 96 Tests
EUR 689

MIP-3

EF017888 96 Tests
EUR 689

MIP-1

EF012725 96 Tests
EUR 689

MIP-3

EF012726 96 Tests
EUR 689

MIP-1

EF013758 96 Tests
EUR 689

MIP-1

EF013759 96 Tests
EUR 689

MIP-3

EF013760 96 Tests
EUR 689

MIP-3

EF013761 96 Tests
EUR 689

MIP-3

EF010865 96 Tests
EUR 689

MIP siRNA

20-abx924187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIP siRNA

20-abx924188
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIP Antibody

36125-100ul 100ul
EUR 252

MIP antibody

10R-10490 100 ug
EUR 435
Description: Mouse monoclonal MIP antibody

MIP antibody

10R-10491 100 ug
EUR 435
Description: Mouse monoclonal MIP antibody

MIP antibody

70R-18519 50 ul
EUR 435
Description: Rabbit polyclonal MIP antibody

MIP Antibody

1-CSB-PA884370
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MIP. Recognizes MIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

MIP Antibody

1-CSB-PA000910
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MIP. Recognizes MIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

MIP Antibody

1-CSB-PA013834GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MIP. Recognizes MIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MIP Antibody

1-CSB-PA013834LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIP. Recognizes MIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

mip Antibody

1-CSB-PA401660HA01LLJ
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mip. Recognizes mip from Legionella pneumophila. This antibody is Unconjugated. Tested in the following application: ELISA

MIP Antibody

1-CSB-PA283369
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MIP. Recognizes MIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MIP Antibody

1-CSB-PA152107
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MIP. Recognizes MIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:50-1:200

MIP Antibody

1-CSB-PA167583
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MIP. Recognizes MIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MIP-3

PAab09791 100 ug
EUR 386

ELISA kit for Mouse MIP-2

EK5190 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse MIP-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat MIP-2

EK5301 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat MIP-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse MIP-2 PicoKine ELISA Kit

EK0452 96 wells
EUR 476
Description: For quantitative detection of mouse MIP-2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig MIP-2 ELISA Kit

EGM0018 96Tests
EUR 521

GRO beta / MIP-2 (CXCL2) Protein

20-abx261572
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GRO beta / MIP-2 (CXCL2) Protein

20-abx261590
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO beta / MIP-2 (CXCL2) Protein

20-abx261604
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

MIP-2/Gro-beta, murine recombinant

4251-1000
EUR 5204

MIP-2/Gro-beta, murine recombinant

4251-20
EUR 297

GRO-beta/MIP-2, rat recombinant

4108-1000
EUR 3965

GRO-beta/MIP-2, rat recombinant

4108-20
EUR 262

Recombinant Murine MIP-2 (CXCL2) Protein

PROTP10889-1 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine MIP-2 is a 7.8 kDa protein consisting of 73 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Mouse MIP-2 ELISA kit (4X96T)

LF-EK50670 4×96T
EUR 2201

Mouse MIP-2/CXCL2 ELISA Kit

RK00165 96 Tests
EUR 521

MIP-2 ELISA Kit (Mouse) (OKBB00216)

OKBB00216 96 Tests
EUR 570
Description: Description of target: MIP is a member of the aquaporin family of membrane-bound water channels. MIP family proteins are thought to contain 6 TM domains. Sequence analysis suggests that the proteins may have arisen through tandem, intragenic duplication from an ancestral protein that contained 3 TM domains. Major intrinsic protein (MIP, also called MP26) is the predominant fiber cell membrane protein of the ocular lens. The major intrinsic protein (MIP) of the vertebrate eye lens is the first identified member of a sequence-related family of cell-membrane proteins that appears to have evolved by gene duplication. Several members of the MIP family transport water (aquaporins), glycerol and other small molecules in microbial, plant and animal cells. The standard used in this kit is recombinant mouse MIP-2(A28-N100), consisting of 73 amino acids with the molecular mass of 8KDa;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5 pg/mL

MIP-1Beta/ Rat MIP- 1Beta ELISA Kit

ELA-E0093r 96 Tests
EUR 886

MIP-3Alpha/ Rat MIP- 3Alpha ELISA Kit

ELA-E0095r 96 Tests
EUR 886

MIP-3Beta/ Rat MIP- 3Beta ELISA Kit

ELA-E0096r 96 Tests
EUR 886

MIP-5/ Rat MIP- 5 ELISA Kit

ELA-E0550r 96 Tests
EUR 886

Legionella pneumophila Outer membrane protein MIP (mip)

1-CSB-YP401660LLJ
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Legionella pneumophila Outer membrane protein MIP(mip) expressed in Yeast

Legionella pneumophila Outer membrane protein MIP (mip)

1-CSB-EP401660LLJ
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Legionella pneumophila Outer membrane protein MIP(mip) expressed in E.coli

Macrophage Inflammatory Protein 2 (MIP-2) Antibody (Biotin)

abx411720-50ug 50 ug
EUR 676
  • Shipped within 1 week.

Polyclonal Goat Anti-CXCL2 / MIP-2 Antibody

APR16257G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CXCL2 / MIP-2 . This antibody is tested and proven to work in the following applications:

Rat CXCL2/MIP-2 PicoKine ELISA Kit

EK0725 96 wells
EUR 425
Description: For quantitative detection of rat MIP-2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

GRO beta / MIP-2 (CXCL2) His Protein

20-abx260689
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Human GRO-beta/MIP-2 (CXCL2)

7-01864 2µg Ask for price

Recombinant Human GRO-beta/MIP-2 (CXCL2)

7-01865 10µg Ask for price

Recombinant Human GRO-beta/MIP-2 (CXCL2)

7-01866 1mg Ask for price

Recombinant Mouse GRO-beta/MIP-2 (CXCL2)

7-01870 5µg Ask for price

Recombinant Mouse GRO-beta/MIP-2 (CXCL2)

7-01871 20µg Ask for price

metap2

Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

DLR-METAP2-Hu-96T 96T
EUR 673
  • Should the Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Methionyl Aminopeptidase 2 (METAP2) in samples from tissue homogenates or other biological fluids.

Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

RDR-METAP2-Hu-48Tests 48 Tests
EUR 544

Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

RDR-METAP2-Hu-96Tests 96 Tests
EUR 756

Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

RD-METAP2-Hu-48Tests 48 Tests
EUR 521

Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

RD-METAP2-Hu-96Tests 96 Tests
EUR 723

Metap2/ Rat Metap2 ELISA Kit

ELI-24601r 96 Tests
EUR 886

METAP2 antibody

70R-18482 50 ul
EUR 435
Description: Rabbit polyclonal METAP2 antibody

METAP2 antibody

70R-2897 50 ug
EUR 467
Description: Rabbit polyclonal METAP2 antibody raised against the N terminal of METAP2

METAP2 Antibody

45294-100ul 100ul
EUR 252

METAP2 Antibody

45294-50ul 50ul
EUR 187

METAP2 Antibody

DF8406 200ul
EUR 304
Description: METAP2 Antibody detects endogenous levels of total METAP2.

METAP2 Antibody

1-CSB-PA013716GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against METAP2. Recognizes METAP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

METAP2 Antibody

1-CSB-PA013716LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against METAP2. Recognizes METAP2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

METAP2 siRNA

20-abx903224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

METAP2 siRNA

20-abx923955
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

METAP2 siRNA

20-abx923956
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

METAP2 Antibody

ABD8406 100 ug
EUR 438

anti-METAP2

YF-PA17348 50 ug
EUR 363
Description: Mouse polyclonal to METAP2

METAP2 Blocking Peptide

33R-1556 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of METAP2 antibody, catalog no. 70R-2897

METAP2 Blocking Peptide

DF8406-BP 1mg
EUR 195

METAP2 Conjugated Antibody

C45294 100ul
EUR 397

METAP2 Rabbit pAb

A5962-100ul 100 ul
EUR 308

METAP2 Rabbit pAb

A5962-200ul 200 ul
EUR 459

METAP2 Rabbit pAb

A5962-20ul 20 ul
EUR 183

METAP2 Rabbit pAb

A5962-50ul 50 ul
EUR 223

anti- METAP2 antibody

FNab05135 100µg
EUR 505.25
  • Immunogen: methionyl aminopeptidase 2
  • Uniprot ID: P50579
  • Gene ID: 10988
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against METAP2

Anti-METAP2 antibody

PAab05135 100 ug
EUR 355

pCMV-SPORT6-METAP2

PVT13950 2 ug
EUR 391

Anti-METAP2 antibody

STJ111259 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the methionyl aminopeptidase family. The encoded protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent proteins. Increased expression of this gene is associated with various forms of cancer, and the anti-cancer drugs fumagillin and ovalicin inhibit the protein by irreversibly binding to its active site. Inhibitors of this gene have also been shown to be effective for the treatment of obesity. A pseudogene of this gene is located on chromosome 2. Several transcript variants encoding different isoforms have been found for this gene.

Mouse METAP2 shRNA Plasmid

20-abx974688
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat METAP2 shRNA Plasmid

20-abx986228
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

METAP2 Antibody, HRP conjugated

1-CSB-PA013716LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against METAP2. Recognizes METAP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

METAP2 Antibody, FITC conjugated

1-CSB-PA013716LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against METAP2. Recognizes METAP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

METAP2 Antibody, Biotin conjugated

1-CSB-PA013716LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against METAP2. Recognizes METAP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human METAP2 shRNA Plasmid

20-abx957503
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

METAP2 Recombinant Protein (Human)

RP070431 100 ug Ask for price

METAP2 Recombinant Protein (Mouse)

RP150269 100 ug Ask for price

METAP2 Recombinant Protein (Rat)

RP211421 100 ug Ask for price

METAP2 (Human) ELISA Kit

E4807-100 96assays
EUR 784

Human Methionine aminopeptidase 2 (METAP2)

1-CSB-EP013716HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 59.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Methionine aminopeptidase 2(METAP2) expressed in E.coli

Human Methionine aminopeptidase 2 (METAP2)

1-CSB-YP013716HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Methionine aminopeptidase 2(METAP2) expressed in Yeast

Methionine Aminopeptidase 2 (METAP2) Antibody

abx028022-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Methionine Aminopeptidase 2 (METAP2) Antibody

abx028022-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Methionine Aminopeptidase 2 (METAP2) Antibody

20-abx216811
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methionyl Aminopeptidase 2 (METAP2) Antibody

20-abx177550
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Methionyl Aminopeptidase 2 (METAP2) Antibody

20-abx177551
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Methionyl Aminopeptidase 2 (METAP2) Antibody

20-abx113705
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine Aminopeptidase 2 (METAP2) Antibody

20-abx123839
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionyl Aminopeptidase 2 (METAP2) Antibody

20-abx173559
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Methionine Aminopeptidase 2 (METAP2) Antibody

abx031583-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Methionine Aminopeptidase 2 (METAP2) Antibody

abx031583-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal METAP2 Antibody (N-term)

APR08422G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human METAP2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal METAP2 Antibody (N-term)

APR08423G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human METAP2 (N-term). This antibody is tested and proven to work in the following applications:

Methionyl Aminopeptidase 2 (METAP2) Antibody

20-abx338835
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methionine Aminopeptidase 2 (METAP2) Antibody

abx235135-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Metap2 ORF Vector (Rat) (pORF)

ORF070475 1.0 ug DNA
EUR 506

METAP2 ORF Vector (Human) (pORF)

ORF023478 1.0 ug DNA
EUR 405

Metap2 ORF Vector (Mouse) (pORF)

ORF050091 1.0 ug DNA
EUR 506

Recombinant Methionyl Aminopeptidase 2 (METAP2)

4-RPH663Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.5kDa
  • Isoelectric Point: 5.6
Description: Recombinant Human Methionyl Aminopeptidase 2 expressed in: E.coli

METAP2 ELISA Kit (Human) (OKCD02723)

OKCD02723 96 Wells
EUR 831
Description: Description of target: Cotranslationally removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and uncharged (Met-Ala-, Cys, Gly, Pro, Ser, Thr, or Val). The catalytic activity of human METAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. Protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. Plays a critical role in the regulation of protein synthesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

METAP2 ELISA Kit (Human) (OKCA02120)

OKCA02120 96 Wells
EUR 833
Description: Description of target: Cotranslationally removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and uncharged (Met-Ala-, Cys, Gly, Pro, Ser, Thr, or Val). The catalytic activity of human METAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. Protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. Plays a critical role in the regulation of protein synthesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

METAP2 ELISA Kit (Mouse) (OKCD09078)

OKCD09078 96 Wells
EUR 1001
Description: Description of target: Cotranslationally removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and uncharged (Met-Ala-, Cys, Gly, Pro, Ser, Thr, or Val).UniRule annotation;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

METAP2 ELISA Kit (Mouse) (OKEH03636)

OKEH03636 96 Wells
EUR 779
Description: Description of target: Cotranslationally removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and uncharged (Met-Ala-, Cys, Gly, Pro, Ser, Thr, or Val).UniRule annotation;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.39 ng/mL

Methionyl Aminopeptidase 2 (METAP2) Antibody (HRP)

20-abx336513
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methionyl Aminopeptidase 2 (METAP2) Antibody (FITC)

20-abx336514
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Methionyl Aminopeptidase 2 (METAP2) Antibody (Biotin)

20-abx336515
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Methionyl Aminopeptidase 2 (METAP2) Protein

20-abx654361
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Methionyl Aminopeptidase 2 (METAP2) Protein

20-abx654362
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Metap2 sgRNA CRISPR Lentivector set (Mouse)

K4809401 3 x 1.0 ug
EUR 339

Metap2 sgRNA CRISPR Lentivector set (Rat)

K6952901 3 x 1.0 ug
EUR 339

METAP2 sgRNA CRISPR Lentivector set (Human)

K1292501 3 x 1.0 ug
EUR 339

Human Methionyl Aminopeptidase 2 (METAP2)ELISA Kit

201-12-2383 96 tests
EUR 440
  • This Methionyl Aminopeptidase 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

20-abx156994
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Methionyl Aminopeptidase 2 (METAP2) ELISA Kit

20-abx152319
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Methionine aminopeptidase 2 (METAP2) ELISA Kit

abx254939-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Metap2/ Methionine aminopeptidase 2 ELISA Kit

E0942Mo 1 Kit
EUR 632

Rat Metap2/ Methionine aminopeptidase 2 ELISA Kit

E1113Ra 1 Kit
EUR 646

Human METAP2/ Methionine aminopeptidase 2 ELISA Kit

E1581Hu 1 Kit
EUR 605

Human Methionine aminopeptidase 2, METAP2 ELISA KIT

ELI-24179h 96 Tests
EUR 824

Bovine Methionine aminopeptidase 2, METAP2 ELISA KIT

ELI-24600b 96 Tests
EUR 928

Human Methionine aminopeptidase 2 (METAP2) ELISA Kit

abx571187-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Methionine aminopeptidase 2 (METAP2) ELISA Kit

abx516506-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Methionine aminopeptidase 2 (METAP2) ELISA Kit

abx516510-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Methionyl Aminopeptidase 2 (METAP2) CLIA Kit

20-abx495506
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Methionyl Aminopeptidase 2 (METAP2) CLIA Kit

20-abx495507
  • EUR 7973.00
  • EUR 4246.00