SCMH1 antibody
70R-20110	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SCMH1 antibody

SCMH1 antibody
70R-13047	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal SCMH1 antibody

SCMH1 siRNA
20-abx932603	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCMH1 siRNA
20-abx932604	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCMH1 Antibody
1-CSB-PA846625LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

SCMH1 Antibody
1-CSB-PA020828GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-SCMH1
YF-PA17693	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SCMH1

anti-SCMH1
YF-PA25824	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SCMH1

Mouse Polycomb protein SCMH1, Scmh1 ELISA KIT
ELI-15469m	Lifescience Market	96 Tests	EUR 865

Human Polycomb protein SCMH1, SCMH1 ELISA KIT
ELI-53042h	Lifescience Market	96 Tests	EUR 824

anti- SCMH1 antibody
FNab07638	FN Test	100µg	EUR 548.75
Immunogen: sex comb on midleg homolog 1(Drosophila) Uniprot ID: Q96GD3 Gene ID: 22955 Research Area: Metabolism, Developmental biology
Description: Antibody raised against SCMH1

SCMH1 Polyclonal Antibody
A66818	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SCMH1 cloning plasmid
CSB-CL846625HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1983 Sequence: atgctggtttgctacagtgttttagcttgtgagattctctgggaccttccctgctccatcatggggtcacctctaggtcattttacctgggacaaatacctaaaagaaacatgttcagtcccagcgcctgtccattgcttcaagcagtcctacacacctccaagcaacgagttca Show more
Description: A cloning plasmid for the SCMH1 gene.

SCMH1 cloning plasmid
CSB-CL846625HU2-10ug	Cusabio	10ug	EUR 614
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1800 Sequence: atgaaattggaagcacaggaccccaggaacaccacatccacctgtattgccacagtagttggactgacaggtgcccgccttcgcctgcgccttgatgggagcgacaacaaaaatgacttctggcggctggttgactcagctgaaatccagcctattgggaactgtgaaaagaatg Show more
Description: A cloning plasmid for the SCMH1 gene.

Anti-SCMH1 antibody
PAab07638	Lifescience Market	100 ug	EUR 386

Anti-SCMH1 (2D7)
YF-MA17778	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SCMH1

Anti-SCMH1 (1H2)
YF-MA17779	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SCMH1

Mouse SCMH1 shRNA Plasmid
20-abx974006	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SCMH1 ELISA KIT|Human
EF002748	Lifescience Market	96 Tests	EUR 689

Human SCMH1 shRNA Plasmid
20-abx957898	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SCMH1 Antibody, HRP conjugated
1-CSB-PA846625LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCMH1 Antibody, FITC conjugated
1-CSB-PA846625LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCMH1 Antibody, Biotin conjugated
1-CSB-PA846625LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SCMH1 Recombinant Protein (Human)
RP027751	ABM	100 ug	Ask for price

SCMH1 Recombinant Protein (Human)
RP027754	ABM	100 ug	Ask for price

SCMH1 Recombinant Protein (Rat)
RP227654	ABM	100 ug	Ask for price

SCMH1 Recombinant Protein (Mouse)
RP170249	ABM	100 ug	Ask for price

SCMH1 Recombinant Protein (Mouse)
RP170252	ABM	100 ug	Ask for price

SCMH1 Polyclonal Antibody, HRP Conjugated
A66819	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SCMH1 Polyclonal Antibody, FITC Conjugated
A66820	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SCMH1 Polyclonal Antibody, Biotin Conjugated
A66821	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SCMH1 ORF Vector (Human) (pORF)
ORF009251	ABM	1.0 ug DNA	EUR 95

SCMH1 ORF Vector (Human) (pORF)
ORF009252	ABM	1.0 ug DNA	EUR 95

Scmh1 ORF Vector (Mouse) (pORF)
ORF056751	ABM	1.0 ug DNA	EUR 506

Scmh1 ORF Vector (Mouse) (pORF)
ORF056752	ABM	1.0 ug DNA	EUR 506

Scmh1 ORF Vector (Rat) (pORF)
ORF075886	ABM	1.0 ug DNA	EUR 506

SCMH1 sgRNA CRISPR Lentivector set (Human)
K2101601	ABM	3 x 1.0 ug	EUR 339

Scmh1 sgRNA CRISPR Lentivector set (Rat)
K6362201	ABM	3 x 1.0 ug	EUR 339

Scmh1 sgRNA CRISPR Lentivector set (Mouse)
K4949901	ABM	3 x 1.0 ug	EUR 339

SCMH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2101602	ABM	1.0 ug DNA	EUR 154

SCMH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2101603	ABM	1.0 ug DNA	EUR 154

SCMH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2101604	ABM	1.0 ug DNA	EUR 154

Scmh1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6362202	ABM	1.0 ug DNA	EUR 154

Scmh1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6362203	ABM	1.0 ug DNA	EUR 154

Scmh1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6362204	ABM	1.0 ug DNA	EUR 154

Scmh1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4949902	ABM	1.0 ug DNA	EUR 154

Scmh1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4949903	ABM	1.0 ug DNA	EUR 154

Scmh1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4949904	ABM	1.0 ug DNA	EUR 154

SCMH1 Protein Vector (Human) (pPB-C-His)
PV037001	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPB-N-His)
PV037002	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPM-C-HA)
PV037003	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPM-C-His)
PV037004	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPB-C-His)
PV037005	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPB-N-His)
PV037006	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPM-C-HA)
PV037007	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Human) (pPM-C-His)
PV037008	ABM	500 ng	EUR 329

SCMH1 Protein Vector (Rat) (pPB-C-His)
PV303542	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Rat) (pPB-N-His)
PV303543	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Rat) (pPM-C-HA)
PV303544	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Rat) (pPM-C-His)
PV303545	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Mouse) (pPB-C-His)
PV227002	ABM	500 ng	EUR 1065

SCMH1 Protein Vector (Mouse) (pPB-N-His)
PV227003	ABM	500 ng	EUR 1065

SCMH1 Protein Vector (Mouse) (pPM-C-HA)
PV227004	ABM	500 ng	EUR 1065

SCMH1 Protein Vector (Mouse) (pPM-C-His)
PV227005	ABM	500 ng	EUR 1065

SCMH1 Protein Vector (Mouse) (pPB-C-His)
PV227006	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Mouse) (pPB-N-His)
PV227007	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Mouse) (pPM-C-HA)
PV227008	ABM	500 ng	EUR 603

SCMH1 Protein Vector (Mouse) (pPM-C-His)
PV227009	ABM	500 ng	EUR 603

Scmh1 3'UTR GFP Stable Cell Line
TU168412	ABM	1.0 ml	Ask for price

SCMH1 3'UTR Luciferase Stable Cell Line
TU022717	ABM	1.0 ml	EUR 1394

Scmh1 3'UTR Luciferase Stable Cell Line
TU118412	ABM	1.0 ml	Ask for price

SCMH1 3'UTR GFP Stable Cell Line
TU072717	ABM	1.0 ml	EUR 1394

Scmh1 3'UTR Luciferase Stable Cell Line
TU219979	ABM	1.0 ml	Ask for price

Scmh1 3'UTR GFP Stable Cell Line
TU269979	ABM	1.0 ml	Ask for price

SCMH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV714831	ABM	1.0 ug DNA	EUR 316

SCMH1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV714835	ABM	1.0 ug DNA	EUR 316

SCMH1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV714836	ABM	1.0 ug DNA	EUR 316

Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody
20-abx309833	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody
abx237638-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody (HRP)
20-abx309834	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody (FITC)
20-abx309835	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody (Biotin)
20-abx309836	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SCMH1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2101605	ABM	3 x 1.0 ug	EUR 376

Scmh1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6362205	ABM	3 x 1.0 ug	EUR 376

Scmh1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4949905	ABM	3 x 1.0 ug	EUR 376