SCMH1

SCMH1 antibody
70R-20110 50 ul
EUR 435
Description: Rabbit polyclonal SCMH1 antibody
SCMH1 antibody
70R-13047 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SCMH1 antibody
SCMH1 siRNA
20-abx932603
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCMH1 siRNA
20-abx932604
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCMH1 Antibody
1-CSB-PA846625LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
SCMH1 Antibody
1-CSB-PA020828GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
anti-SCMH1
YF-PA17693 100 ug
EUR 403
Description: Rabbit polyclonal to SCMH1
anti-SCMH1
YF-PA25824 50 ul
EUR 334
Description: Mouse polyclonal to SCMH1
Mouse Polycomb protein SCMH1, Scmh1 ELISA KIT
ELI-15469m 96 Tests
EUR 865
Human Polycomb protein SCMH1, SCMH1 ELISA KIT
ELI-53042h 96 Tests
EUR 824
anti- SCMH1 antibody
FNab07638 100µg
EUR 548.75
  • Immunogen: sex comb on midleg homolog 1(Drosophila)
  • Uniprot ID: Q96GD3
  • Gene ID: 22955
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against SCMH1
SCMH1 Polyclonal Antibody
A66818 100 µg
EUR 570.55
Description: Ask the seller for details
SCMH1 cloning plasmid
CSB-CL846625HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1983
  • Sequence: atgctggtttgctacagtgttttagcttgtgagattctctgggaccttccctgctccatcatggggtcacctctaggtcattttacctgggacaaatacctaaaagaaacatgttcagtcccagcgcctgtccattgcttcaagcagtcctacacacctccaagcaacgagttca
  • Show more
Description: A cloning plasmid for the SCMH1 gene.
SCMH1 cloning plasmid
CSB-CL846625HU2-10ug 10ug
EUR 614
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1800
  • Sequence: atgaaattggaagcacaggaccccaggaacaccacatccacctgtattgccacagtagttggactgacaggtgcccgccttcgcctgcgccttgatgggagcgacaacaaaaatgacttctggcggctggttgactcagctgaaatccagcctattgggaactgtgaaaagaatg
  • Show more
Description: A cloning plasmid for the SCMH1 gene.
Anti-SCMH1 antibody
PAab07638 100 ug
EUR 386
Anti-SCMH1 (2D7)
YF-MA17778 100 ug
EUR 363
Description: Mouse monoclonal to SCMH1
Anti-SCMH1 (1H2)
YF-MA17779 100 ug
EUR 363
Description: Mouse monoclonal to SCMH1
Mouse SCMH1 shRNA Plasmid
20-abx974006
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SCMH1 ELISA KIT|Human
EF002748 96 Tests
EUR 689
Human SCMH1 shRNA Plasmid
20-abx957898
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SCMH1 Antibody, HRP conjugated
1-CSB-PA846625LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SCMH1 Antibody, FITC conjugated
1-CSB-PA846625LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SCMH1 Antibody, Biotin conjugated
1-CSB-PA846625LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCMH1. Recognizes SCMH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SCMH1 Recombinant Protein (Human)
RP027751 100 ug Ask for price
SCMH1 Recombinant Protein (Human)
RP027754 100 ug Ask for price
SCMH1 Recombinant Protein (Rat)
RP227654 100 ug Ask for price
SCMH1 Recombinant Protein (Mouse)
RP170249 100 ug Ask for price
SCMH1 Recombinant Protein (Mouse)
RP170252 100 ug Ask for price
SCMH1 Polyclonal Antibody, HRP Conjugated
A66819 100 µg
EUR 570.55
Description: The best epigenetics products
SCMH1 Polyclonal Antibody, FITC Conjugated
A66820 100 µg
EUR 570.55
Description: kits suitable for this type of research
SCMH1 Polyclonal Antibody, Biotin Conjugated
A66821 100 µg
EUR 570.55
Description: fast delivery possible
SCMH1 ORF Vector (Human) (pORF)
ORF009251 1.0 ug DNA
EUR 95
SCMH1 ORF Vector (Human) (pORF)
ORF009252 1.0 ug DNA
EUR 95
Scmh1 ORF Vector (Mouse) (pORF)
ORF056751 1.0 ug DNA
EUR 506
Scmh1 ORF Vector (Mouse) (pORF)
ORF056752 1.0 ug DNA
EUR 506
Scmh1 ORF Vector (Rat) (pORF)
ORF075886 1.0 ug DNA
EUR 506
SCMH1 sgRNA CRISPR Lentivector set (Human)
K2101601 3 x 1.0 ug
EUR 339
Scmh1 sgRNA CRISPR Lentivector set (Rat)
K6362201 3 x 1.0 ug
EUR 339
Scmh1 sgRNA CRISPR Lentivector set (Mouse)
K4949901 3 x 1.0 ug
EUR 339
SCMH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2101602 1.0 ug DNA
EUR 154
SCMH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2101603 1.0 ug DNA
EUR 154
SCMH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2101604 1.0 ug DNA
EUR 154
Scmh1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6362202 1.0 ug DNA
EUR 154
Scmh1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6362203 1.0 ug DNA
EUR 154
Scmh1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6362204 1.0 ug DNA
EUR 154
Scmh1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4949902 1.0 ug DNA
EUR 154
Scmh1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4949903 1.0 ug DNA
EUR 154
Scmh1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4949904 1.0 ug DNA
EUR 154
SCMH1 Protein Vector (Human) (pPB-C-His)
PV037001 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPB-N-His)
PV037002 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPM-C-HA)
PV037003 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPM-C-His)
PV037004 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPB-C-His)
PV037005 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPB-N-His)
PV037006 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPM-C-HA)
PV037007 500 ng
EUR 329
SCMH1 Protein Vector (Human) (pPM-C-His)
PV037008 500 ng
EUR 329
SCMH1 Protein Vector (Rat) (pPB-C-His)
PV303542 500 ng
EUR 603
SCMH1 Protein Vector (Rat) (pPB-N-His)
PV303543 500 ng
EUR 603
SCMH1 Protein Vector (Rat) (pPM-C-HA)
PV303544 500 ng
EUR 603
SCMH1 Protein Vector (Rat) (pPM-C-His)
PV303545 500 ng
EUR 603
SCMH1 Protein Vector (Mouse) (pPB-C-His)
PV227002 500 ng
EUR 1065
SCMH1 Protein Vector (Mouse) (pPB-N-His)
PV227003 500 ng
EUR 1065
SCMH1 Protein Vector (Mouse) (pPM-C-HA)
PV227004 500 ng
EUR 1065
SCMH1 Protein Vector (Mouse) (pPM-C-His)
PV227005 500 ng
EUR 1065
SCMH1 Protein Vector (Mouse) (pPB-C-His)
PV227006 500 ng
EUR 603
SCMH1 Protein Vector (Mouse) (pPB-N-His)
PV227007 500 ng
EUR 603
SCMH1 Protein Vector (Mouse) (pPM-C-HA)
PV227008 500 ng
EUR 603
SCMH1 Protein Vector (Mouse) (pPM-C-His)
PV227009 500 ng
EUR 603
Scmh1 3'UTR GFP Stable Cell Line
TU168412 1.0 ml Ask for price
SCMH1 3'UTR Luciferase Stable Cell Line
TU022717 1.0 ml
EUR 1394
Scmh1 3'UTR Luciferase Stable Cell Line
TU118412 1.0 ml Ask for price
SCMH1 3'UTR GFP Stable Cell Line
TU072717 1.0 ml
EUR 1394
Scmh1 3'UTR Luciferase Stable Cell Line
TU219979 1.0 ml Ask for price
Scmh1 3'UTR GFP Stable Cell Line
TU269979 1.0 ml Ask for price
SCMH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV714831 1.0 ug DNA
EUR 316
SCMH1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV714835 1.0 ug DNA
EUR 316
SCMH1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV714836 1.0 ug DNA
EUR 316
Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody
20-abx309833
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody
abx237638-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody (HRP)
20-abx309834
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody (FITC)
20-abx309835
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sex Comb On Midleg Homolog 1 (Drosophila) (SCMH1) Antibody (Biotin)
20-abx309836
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SCMH1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2101605 3 x 1.0 ug
EUR 376
Scmh1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6362205 3 x 1.0 ug
EUR 376
Scmh1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4949905 3 x 1.0 ug
EUR 376