Human HGD(Homogentisate-1,2-Dioxygenase) ELISA Kit


Human HGD(Homogentisate-1,2-Dioxygenase) ELISA Kit 

Order Now:

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
DLR-HGD-Hu-96T 96T
EUR 673
  • Should the Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RD-HGD-Hu-48Tests 48 Tests
EUR 521
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RD-HGD-Hu-96Tests 96 Tests
EUR 723
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RDR-HGD-Hu-48Tests 48 Tests
EUR 544
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RDR-HGD-Hu-96Tests 96 Tests
EUR 756
Homogentisate 1,2-Dioxygenase (HGD) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Homogentisate-1,2-Dioxygenase (HGD) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Homogentisate-1,2-Dioxygenase (HGD) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Homogentisate-1,2-Dioxygenase (HGD) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Homogentisate 1,2-Dioxygenase (HGD) Antibody
abx038103-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Homogentisate 1,2-Dioxygenase (HGD) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Homogentisate 1,2-Dioxygenase (HGD) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Homogentisate 1,2-Dioxygenase (HGD) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Homogentisate 1,2-Dioxygenase (HGD) Antibody
abx233852-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Homogentisate-1,2-Dioxygenase (HGD)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q93099
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.9kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Homogentisate-1,2-Dioxygenase expressed in: E.coli
Recombinant Homogentisate-1,2-Dioxygenase (HGD)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q93099
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Homogentisate-1,2-Dioxygenase expressed in: E.coli
Recombinant Homogentisate-1,2-Dioxygenase (HGD)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q93099
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 77.2kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Homogentisate-1,2-Dioxygenase expressed in: E.coli
Recombinant Homogentisate-1,2-Dioxygenase (HGD)
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O09173
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.7kDa
  • Isoelectric Point: 6.5
Description: Recombinant Mouse Homogentisate-1,2-Dioxygenase expressed in: E.coli
Human Homogentisate 1,2- dioxygenase, HGD ELISA KIT
ELI-20283h 96 Tests
EUR 824
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Homogentisate-1,2-Dioxygenase (HGD)ELISA Kit
201-12-2435 96 tests
EUR 440
  • This Homogentisate-1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Homogentisate-1,2-Dioxygenase ELISA Kit (HGD)
RK01560 96 Tests
EUR 521
Human Homogentisate-1,2-Dioxygenase(HGD)ELISA Kit
QY-E02060 96T
EUR 361
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.
Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.
Human Homogentisate-1,2-Dioxygenase (HGD) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Homogentisate-1,2-Dioxygenase (HGD) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Homogentisate 1,2- dioxygenase, Hgd ELISA KIT
ELI-27821m 96 Tests
EUR 865
Mouse Homogentisate 1,2-Dioxygenase (HGD) ELISA Kit
abx389562-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Homogentisate-1,2-Dioxygenase(HGD)ELISA Kit
QY-E10638 96T
EUR 361
Mouse Homogentisate-1,2-Dioxygenase(HGD)ELISA Kit
QY-E20761 96T
EUR 361
Human Homogentisate-1,2-Dioxygenase (HGD) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Homogentisate-1,2-Dioxygenase (HGD) Protein
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Homogentisate-1,2-Dioxygenase (HGD) Antibody (Biotin)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Human HGD (Homogentisate-1,2-Dioxygenase)
ELK3589 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Homogentisate-1,2-Dioxygenase (HGD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Homogentisate-1,2-Dioxygenase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Hgd ELISA Kit| Mouse Homogentisate 1,2-dioxygenase ELISA Kit
EF015196 96 Tests
EUR 689
Human Homogentisate 1, 2-dioxygenase (HGD)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Homogentisate 1,2-dioxygenase(HGD) expressed in E.coli
Human Homogentisate-1, 2-Dioxygenase (HGD) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Homogentisate-1, 2-Dioxygenase elisa. Alternative names of the recognized antigen: AKU
  • HGO
  • Homogentisic Acid Oxidase
  • Homogentisicase
  • Homogentisate oxygenase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Homogentisate-1, 2-Dioxygenase (HGD) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD)
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD)
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Biotin.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Cy3.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with FITC.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with HRP.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with PE.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD)
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Biotin.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Cy3.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with FITC.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with HRP.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with PE.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val239~Glu428)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC-Cy7.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Biotin.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Cy3.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with FITC.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with HRP.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with PE.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Ser8~Gly205)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC-Cy7.
Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HGD (Val190~Pro429)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC-Cy7.
EF010113 96 Tests
EUR 689
Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E01D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E01D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E01D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
DLR-PLOD1-Hu-48T 48T
EUR 517
  • Should the Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
DLR-PLOD1-Hu-96T 96T
EUR 673
  • Should the Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RD-PLOD1-Hu-48Tests 48 Tests
EUR 521
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RD-PLOD1-Hu-96Tests 96 Tests
EUR 723
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RDR-PLOD1-Hu-48Tests 48 Tests
EUR 544
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RDR-PLOD1-Hu-96Tests 96 Tests
EUR 756
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.
HGD ELISA Kit (Human) (OKCD00419)
OKCD00419 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL
HGD ELISA Kit (Human) (OKAN06168)
OKAN06168 96 Wells
EUR 792
Description: Description of target: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL
HGD ELISA Kit (Human) (OKDD00306)
OKDD00306 96 Wells
EUR 975
Description: Description of target: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL
ELISA kit for Human PLOD1 (Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1)
ELK4843 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjug
  • Show more
Description: A sandwich ELISA kit for detection of Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E06D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E06D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E06D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E02D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E02D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E02D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E03D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E03D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E03D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E04D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E04D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E04D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E08D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E08D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E08D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E09D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E09D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E09D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E07D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E07D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E07D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Methyl homogentisate
TBZ1652 unit Ask for price
Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E05D0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E05D0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E05D0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Eukaryotic Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1)
  • EUR 718.24
  • EUR 295.00
  • EUR 2418.40
  • EUR 872.80
  • EUR 1645.60
  • EUR 544.00
  • EUR 5896.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q02809
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 12.1kDa
  • Isoelectric Point: 9.1
Description: Recombinant Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 expressed in: E.coli
Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
abx026944-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
abx026944-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q02809
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.2kDa
  • Isoelectric Point: 9.1
Description: Recombinant Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 expressed in: E.coli
Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) ELISA Kit
abx386868-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human Methylcytosine dioxygenase ELISA kit
E01T0868-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Methylcytosine dioxygenase ELISA kit
E01T0868-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Methylcytosine dioxygenase ELISA kit
E01T0868-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HGD antibody
70R-2873 50 ug
EUR 467
Description: Rabbit polyclonal HGD antibody
HGD Antibody
39460-100ul 100ul
EUR 390
HGD Antibody
43078-100ul 100ul
EUR 252
HGD antibody
70R-17730 50 ul
EUR 435
Description: Rabbit polyclonal HGD antibody
HGD Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HGD. Recognizes HGD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
HGD Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HGD. Recognizes HGD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
HGD Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HGD. Recognizes HGD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
YF-PA12299 50 ul
EUR 363
Description: Mouse polyclonal to HGD
YF-PA12300 50 ug
EUR 363
Description: Mouse polyclonal to HGD
YF-PA12301 100 ug
EUR 403
Description: Rabbit polyclonal to HGD
YF-PA23874 50 ul
EUR 334
Description: Mouse polyclonal to HGD
ELISA kit for Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE62072-48T 48T
EUR 332
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE62072-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE62072-96T 96T
EUR 539
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human HGD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HGD Recombinant Protein (Human)
RP014620 100 ug Ask for price
Dhdh ELISA Kit| Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydro
EF014693 96 Tests
EUR 689
DHDH ELISA Kit| Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydr
EF011317 96 Tests
EUR 689
Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) ELISA Kit
abx389064-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Tryptophan 2,3 dioxygenase ELISA kit
E01T0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tryptophan 2,3 dioxygenase ELISA kit
E01T0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tryptophan 2,3 dioxygenase ELISA kit
E01T0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Indoleamine 2,3 Dioxygenase ELISA kit
E01I0057-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Indoleamine 2,3 Dioxygenase ELISA kit
E01I0057-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Indoleamine 2,3 Dioxygenase ELISA kit
E01I0057-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
HGD Conjugated Antibody
C43078 100ul
EUR 397
anti- HGD antibody
FNab03852 100µg
EUR 505.25
  • Immunogen: homogentisate 1,2-dioxygenase(homogentisate oxidase)
  • Uniprot ID: Q93099
  • Gene ID: 3081
  • Research Area: Metabolism
Description: Antibody raised against HGD
Anti-HGD Antibody
A01909-1 100ug/vial
EUR 334
HGD Rabbit pAb
A6618-100ul 100 ul
EUR 308
HGD Rabbit pAb
A6618-200ul 200 ul
EUR 459
HGD Rabbit pAb
A6618-20ul 20 ul
EUR 183
HGD Rabbit pAb
A6618-50ul 50 ul
EUR 223
HGD Blocking Peptide
33R-4507 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HGD antibody, catalog no. 70R-2873
HGD cloning plasmid
CSB-CL842354HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atggctgagttaaagtacatttctggatttgggaatgagtgttcttcagaggatcctcgctgcccaggttccctgccagaaggacagaataatcctcaggtctgcccctacaatctctatgctgagcagctctcaggatcggctttcacttgtccacggagcaccaataagagaa
  • Show more
Description: A cloning plasmid for the HGD gene.
Anti-HGD antibody
PAab03852 100 ug
EUR 355
Anti-HGD antibody
STJ28701 100 µl
EUR 277
Description: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.
Anti-HGD (2C10)
YF-MA13435 100 ug
EUR 363
Description: Mouse monoclonal to HGD
Anti-HGD (3G4)
YF-MA13436 100 ug
EUR 363
Description: Mouse monoclonal to HGD
Anti-HGD (1F1)
YF-MA13437 100 ug
EUR 363
Description: Mouse monoclonal to HGD
ELISA kit for Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE71294-48T 48T
EUR 332
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE71294-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE71294-96T 96T
EUR 539
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE80155-48T 48T
EUR 354
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE80155-5platesof96wells 5 plates of 96 wells
EUR 2252
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE80155-96T 96T
EUR 572
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE90112-48T 48T
EUR 354
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE90112-5platesof96wells 5 plates of 96 wells
EUR 2252
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE90112-96T 96T
EUR 572
  • DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE10357-48T 48T
EUR 354
  • Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE10357-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE10357-96T 96T
EUR 572
  • Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE20080-48T 48T
EUR 354
  • Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE20080-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE20080-96T 96T
EUR 572
  • Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
HGD ORF Vector (Human) (pORF)
ORF004874 1.0 ug DNA
EUR 95
Mouse Methylcytosine dioxygenase ELISA kit
E03T0868-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.