Human HGD(Homogentisate-1,2-Dioxygenase) ELISA Kit 

Order Now: lieven@gentaur.com

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
DLR-HGD-Hu-96T	DL Develop	96T	EUR 673
Should the Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RD-HGD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RD-HGD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RDR-HGD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
RDR-HGD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Homogentisate 1,2-Dioxygenase (HGD) Antibody
20-abx113056	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Homogentisate-1,2-Dioxygenase (HGD) Antibody
20-abx102879	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Homogentisate-1,2-Dioxygenase (HGD) Antibody
20-abx102880	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Homogentisate-1,2-Dioxygenase (HGD) Antibody
20-abx102881	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Homogentisate 1,2-Dioxygenase (HGD) Antibody
abx038103-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Homogentisate 1,2-Dioxygenase (HGD) Antibody
20-abx006370	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Homogentisate 1,2-Dioxygenase (HGD) Antibody
20-abx320739	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Homogentisate 1,2-Dioxygenase (HGD) Antibody
20-abx321802	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Homogentisate 1,2-Dioxygenase (HGD) Antibody
abx233852-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Homogentisate-1,2-Dioxygenase (HGD)
4-RPE250Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q93099 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.9kDa Isoelectric Point: 5.8
Description: Recombinant Human Homogentisate-1,2-Dioxygenase expressed in: E.coli

Recombinant Homogentisate-1,2-Dioxygenase (HGD)
4-RPE250Hu02	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q93099 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Homogentisate-1,2-Dioxygenase expressed in: E.coli

Recombinant Homogentisate-1,2-Dioxygenase (HGD)
4-RPE250Hu03	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q93099 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 77.2kDa Isoelectric Point: 6.8
Description: Recombinant Human Homogentisate-1,2-Dioxygenase expressed in: E.coli

Recombinant Homogentisate-1,2-Dioxygenase (HGD)
4-RPE250Mu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O09173 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.7kDa Isoelectric Point: 6.5
Description: Recombinant Mouse Homogentisate-1,2-Dioxygenase expressed in: E.coli

Human Homogentisate 1,2- dioxygenase, HGD ELISA KIT
ELI-20283h	Lifescience Market	96 Tests	EUR 824

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
20-abx151803	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Homogentisate-1,2-Dioxygenase (HGD)ELISA Kit
201-12-2435	SunredBio	96 tests	EUR 440
This Homogentisate-1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Homogentisate-1,2-Dioxygenase ELISA Kit (HGD)
RK01560	Abclonal	96 Tests	EUR 521

Human Homogentisate-1,2-Dioxygenase(HGD)ELISA Kit
QY-E02060	Qayee Biotechnology	96T	EUR 361

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.

Human Homogentisate-1,2-Dioxygenase (HGD) ELISA Kit
SEE250Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Homogentisate-1,2-Dioxygenase (HGD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Homogentisate-1,2-Dioxygenase (HGD) in Tissue homogenates, cell lysates and other biological fluids.

Human Homogentisate-1,2-Dioxygenase (HGD) Protein
20-abx067135	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Homogentisate-1,2-Dioxygenase (HGD) Protein
20-abx067136	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Homogentisate 1,2- dioxygenase, Hgd ELISA KIT
ELI-27821m	Lifescience Market	96 Tests	EUR 865

Mouse Homogentisate 1,2-Dioxygenase (HGD) ELISA Kit
abx389562-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Homogentisate-1,2-Dioxygenase(HGD)ELISA Kit
QY-E10638	Qayee Biotechnology	96T	EUR 361

Mouse Homogentisate-1,2-Dioxygenase(HGD)ELISA Kit
QY-E20761	Qayee Biotechnology	96T	EUR 361

Human Homogentisate-1,2-Dioxygenase (HGD) CLIA Kit
20-abx494552	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Homogentisate-1,2-Dioxygenase (HGD) Protein
20-abx067137	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Homogentisate-1,2-Dioxygenase (HGD) Antibody (Biotin)
20-abx272352	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Human HGD (Homogentisate-1,2-Dioxygenase)
ELK3589	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Homogentisate-1,2-Dioxygenase (HGD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Homogentisate-1,2-Dioxygenase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Hgd ELISA Kit| Mouse Homogentisate 1,2-dioxygenase ELISA Kit
EF015196	Lifescience Market	96 Tests	EUR 689

Human Homogentisate 1, 2-dioxygenase (HGD)
1-CSB-EP842354HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Homogentisate 1,2-dioxygenase(HGD) expressed in E.coli

Human Homogentisate-1, 2-Dioxygenase (HGD) ELISA Kit
4-SEE250Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Homogentisate-1, 2-Dioxygenase elisa. Alternative names of the recognized antigen: AKU HGO Homogentisic Acid Oxidase Homogentisicase Homogentisate oxygenase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Homogentisate-1, 2-Dioxygenase (HGD) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human)
4-PAE250Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD)

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig)
4-PAE250Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD)

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), APC
4-PAE250Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), Biotinylated
4-PAE250Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Biotin.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), Cy3
4-PAE250Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Cy3.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), FITC
4-PAE250Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with FITC.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), HRP
4-PAE250Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with HRP.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), PE
4-PAE250Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with PE.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat)
4-PAE250Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD)

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), APC
4-PAE250Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAE250Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Biotin.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), Cy3
4-PAE250Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Cy3.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), FITC
4-PAE250Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with FITC.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), HRP
4-PAE250Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with HRP.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), PE
4-PAE250Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with PE.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human), APC-Cy7
4-PAE250Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val239~Glu428) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC-Cy7.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), APC
4-PAE250Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAE250Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Biotin.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAE250Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with Cy3.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), FITC
4-PAE250Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with FITC.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), HRP
4-PAE250Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with HRP.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), PE
4-PAE250Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with PE.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAE250Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Ser8~Gly205) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC-Cy7.

Homogentisate-1, 2-Dioxygenase (HGD) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAE250Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HGD (Val190~Pro429) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Homogentisate-1, 2-Dioxygenase (HGD). This antibody is labeled with APC-Cy7.

HGD ELISA KIT|Human
EF010113	Lifescience Market	96 Tests	EUR 689

Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E01D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E01D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E01D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
20-abx152781	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
DLR-PLOD1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
DLR-PLOD1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RD-PLOD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RD-PLOD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RDR-PLOD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
RDR-PLOD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) ELISA Kit
SEE256Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) in Tissue homogenates, cell lysates and other biological fluids.

HGD ELISA Kit (Human) (OKCD00419)
OKCD00419	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

HGD ELISA Kit (Human) (OKAN06168)
OKAN06168	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

HGD ELISA Kit (Human) (OKDD00306)
OKDD00306	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL

ELISA kit for Human PLOD1 (Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1)
ELK4843	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjug Show more
Description: A sandwich ELISA kit for detection of Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E06D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E06D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E06D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E02D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E02D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E02D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E03D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E03D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E03D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E04D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E04D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E04D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E08D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E08D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E08D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E09D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E09D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E09D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E07D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E07D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E07D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) CLIA Kit
20-abx494559	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Methyl homogentisate
TBZ1652	ChemNorm	unit	Ask for price

Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E05D0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E05D0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) ELISA kit
E05D0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 1,2 dihydroxy 3 keto 5 methylthiopentene dioxygenase(ADI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Protein
20-abx167012	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1)
4-EPE256Hu61	Cloud-Clone	EUR 718.24 EUR 295.00 EUR 2418.40 EUR 872.80 EUR 1645.60 EUR 544.00 EUR 5896.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q02809 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 12.1kDa Isoelectric Point: 9.1
Description: Recombinant Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 expressed in: E.coli

Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
20-abx128433	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
20-abx006578	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
abx026944-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
abx026944-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1) Antibody
20-abx174162	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 (PLOD1)
4-RPE256Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q02809 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.2kDa Isoelectric Point: 9.1
Description: Recombinant Human Procollagen Lysine-1,2-Oxoglutarate-5-Dioxygenase 1 expressed in: E.coli

Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) ELISA Kit
abx386868-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Methylcytosine dioxygenase ELISA kit
E01T0868-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylcytosine dioxygenase ELISA kit
E01T0868-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylcytosine dioxygenase ELISA kit
E01T0868-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

HGD siRNA
20-abx919315	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HGD siRNA
20-abx919316	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HGD antibody
70R-2873	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HGD antibody

HGD Antibody
39460-100ul	SAB	100ul	EUR 390

HGD Antibody
43078-100ul	SAB	100ul	EUR 252

HGD antibody
70R-17730	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HGD antibody

HGD Antibody
1-CSB-PA842354ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HGD. Recognizes HGD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

HGD Antibody
1-CSB-PA842354ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HGD. Recognizes HGD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HGD Antibody
1-CSB-PA010326GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HGD. Recognizes HGD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-HGD
YF-PA12299	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HGD

anti-HGD
YF-PA12300	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to HGD

anti-HGD
YF-PA12301	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HGD

anti-HGD
YF-PA23874	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HGD

ELISA kit for Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE62072-48T	Abbkine	48T	EUR 332
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE62072-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE62072-96T	Abbkine	96T	EUR 539
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human HGD shRNA Plasmid
20-abx952099	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HGD Recombinant Protein (Human)
RP014620	ABM	100 ug	Ask for price

Dhdh ELISA Kit| Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydro
EF014693	Lifescience Market	96 Tests	EUR 689

DHDH ELISA Kit| Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydr
EF011317	Lifescience Market	96 Tests	EUR 689

Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) ELISA Kit
abx389064-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tryptophan 2,3 dioxygenase ELISA kit
E01T0142-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophan 2,3 dioxygenase ELISA kit
E01T0142-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophan 2,3 dioxygenase ELISA kit
E01T0142-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoleamine 2,3 Dioxygenase ELISA kit
E01I0057-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoleamine 2,3 Dioxygenase ELISA kit
E01I0057-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoleamine 2,3 Dioxygenase ELISA kit
E01I0057-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

HGD Conjugated Antibody
C43078	SAB	100ul	EUR 397

anti- HGD antibody
FNab03852	FN Test	100µg	EUR 505.25
Immunogen: homogentisate 1,2-dioxygenase(homogentisate oxidase) Uniprot ID: Q93099 Gene ID: 3081 Research Area: Metabolism
Description: Antibody raised against HGD

Anti-HGD Antibody
A01909-1	BosterBio	100ug/vial	EUR 334

HGD Rabbit pAb
A6618-100ul	Abclonal	100 ul	EUR 308

HGD Rabbit pAb
A6618-200ul	Abclonal	200 ul	EUR 459

HGD Rabbit pAb
A6618-20ul	Abclonal	20 ul	EUR 183

HGD Rabbit pAb
A6618-50ul	Abclonal	50 ul	EUR 223

HGD Blocking Peptide
33R-4507	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HGD antibody, catalog no. 70R-2873

HGD cloning plasmid
CSB-CL842354HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1338 Sequence: atggctgagttaaagtacatttctggatttgggaatgagtgttcttcagaggatcctcgctgcccaggttccctgccagaaggacagaataatcctcaggtctgcccctacaatctctatgctgagcagctctcaggatcggctttcacttgtccacggagcaccaataagagaa Show more
Description: A cloning plasmid for the HGD gene.

Anti-HGD antibody
PAab03852	Lifescience Market	100 ug	EUR 355

Anti-HGD antibody
STJ28701	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.

Anti-HGD (2C10)
YF-MA13435	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HGD

Anti-HGD (3G4)
YF-MA13436	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HGD

Anti-HGD (1F1)
YF-MA13437	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HGD

ELISA kit for Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE71294-48T	Abbkine	48T	EUR 332
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE71294-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE71294-96T	Abbkine	96T	EUR 539
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE80155-48T	Abbkine	48T	EUR 354
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE80155-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE80155-96T	Abbkine	96T	EUR 572
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Pig Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE90112-48T	Abbkine	48T	EUR 354
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE90112-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE90112-96T	Abbkine	96T	EUR 572
DHDH encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of tra Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE10357-48T	Abbkine	48T	EUR 354
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T Show more
Description: Quantitative sandwich ELISA for measuring Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE10357-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T Show more
Description: Quantitative sandwich ELISA for measuring Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE10357-96T	Abbkine	96T	EUR 572
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T Show more
Description: Quantitative sandwich ELISA for measuring Bovine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE20080-48T	Abbkine	48T	EUR 354
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T Show more
Description: Quantitative sandwich ELISA for measuring Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE20080-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T Show more
Description: Quantitative sandwich ELISA for measuring Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH)
KTE20080-96T	Abbkine	96T	EUR 572
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. T Show more
Description: Quantitative sandwich ELISA for measuring Canine Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase (DHDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

HGD ORF Vector (Human) (pORF)
ORF004874	ABM	1.0 ug DNA	EUR 95

Mouse Methylcytosine dioxygenase ELISA kit
E03T0868-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.