UBE2H

UBE2H Antibody
1-CSB-PA025455GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2H. Recognizes UBE2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
UBE2H siRNA
20-abx938780
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2H siRNA
20-abx938781
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2H Polyclonal Antibody
30894-100ul 100ul
EUR 252
UBE2H Polyclonal Antibody
30894-50ul 50ul
EUR 187
Human Ube2H Antibody
33310-05111 150 ug
EUR 261
UBE2H cloning plasmid
CSB-CL025455HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 552
  • Sequence: atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctga
  • Show more
Description: A cloning plasmid for the UBE2H gene.
UBE2H Rabbit pAb
A7344-100ul 100 ul
EUR 308
UBE2H Rabbit pAb
A7344-200ul 200 ul
EUR 459
UBE2H Rabbit pAb
A7344-20ul 20 ul
EUR 183
UBE2H Rabbit pAb
A7344-50ul 50 ul
EUR 223
UBE2H Polyclonal Antibody
ABP60820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein
UBE2H Polyclonal Antibody
ABP60820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein
UBE2H Polyclonal Antibody
ABP60820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein
anti- UBE2H antibody
FNab09176 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin-conjugating enzyme E2H
  • Uniprot ID: P62256
  • Gene ID: 7328
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2H
UBE2H Polyclonal Antibody
ES10438-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBE2H from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
UBE2H Polyclonal Antibody
ES10438-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2H from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-UBE2H antibody
PAab09176 100 ug
EUR 386
Anti-UBE2H antibody
STJ29483 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms.
Anti-UBE2H antibody
STJ191596 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2H
UBE2H protein (His tag)
80R-2249 100 ug
EUR 322
Description: Purified recombinant Human UBE2H Protein (His tag)
UBE2H ELISA KIT|Human
EF004004 96 Tests
EUR 689
Mouse UBE2H shRNA Plasmid
20-abx973292
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2H Polyclonal Conjugated Antibody
C30894 100ul
EUR 397
Human UBE2H shRNA Plasmid
20-abx955011
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti-UBE2H (3C4-1A2)
LF-MA10365 100 ug
EUR 363
Description: Mouse monoclonal to UBE2H
UBE2H Recombinant Protein (Rat)
RP235556 100 ug Ask for price
UBE2H Recombinant Protein (Human)
RP033706 100 ug Ask for price
UBE2H Recombinant Protein (Mouse)
RP182654 100 ug Ask for price
UBE2H Recombinant Protein (Mouse)
RP182657 100 ug Ask for price
UBE2H Recombinant Protein (Mouse)
RP182660 100 ug Ask for price
Human Ube2H Antibody (Biotin Conjugate)
33310-05121 150 ug
EUR 369
Ube2h ORF Vector (Rat) (pORF)
ORF078520 1.0 ug DNA
EUR 506
UBE2H ORF Vector (Human) (pORF)
ORF011236 1.0 ug DNA
EUR 95
Ube2h ORF Vector (Mouse) (pORF)
ORF060886 1.0 ug DNA
EUR 506
Ube2h ORF Vector (Mouse) (pORF)
ORF060887 1.0 ug DNA
EUR 506
Ube2h ORF Vector (Mouse) (pORF)
ORF060888 1.0 ug DNA
EUR 506
Human Ube2H AssayLite Antibody (FITC Conjugate)
33310-05141 150 ug
EUR 428
Human Ube2H AssayLite Antibody (RPE Conjugate)
33310-05151 150 ug
EUR 428
Human Ube2H AssayLite Antibody (APC Conjugate)
33310-05161 150 ug
EUR 428
Human Ube2H AssayLite Antibody (PerCP Conjugate)
33310-05171 150 ug
EUR 471
Polyclonal Ube2h Antibody - N-terminal region
APR00871G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ube2h - N-terminal region. This antibody is tested and proven to work in the following applications:
Ube2h sgRNA CRISPR Lentivector set (Rat)
K6090601 3 x 1.0 ug
EUR 339
UBE2H sgRNA CRISPR Lentivector set (Human)
K2572101 3 x 1.0 ug
EUR 339
Ube2h sgRNA CRISPR Lentivector set (Mouse)
K4746401 3 x 1.0 ug
EUR 339
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
20-abx006923
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (ube2h) Antibody
20-abx116469
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
20-abx142292
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
abx029157-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
abx029157-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody
abx239176-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ube2h sgRNA CRISPR Lentivector (Rat) (Target 1)
K6090602 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Rat) (Target 2)
K6090603 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Rat) (Target 3)
K6090604 1.0 ug DNA
EUR 154
UBE2H sgRNA CRISPR Lentivector (Human) (Target 1)
K2572102 1.0 ug DNA
EUR 154
UBE2H sgRNA CRISPR Lentivector (Human) (Target 2)
K2572103 1.0 ug DNA
EUR 154
UBE2H sgRNA CRISPR Lentivector (Human) (Target 3)
K2572104 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4746402 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4746403 1.0 ug DNA
EUR 154
Ube2h sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4746404 1.0 ug DNA
EUR 154
UBE2H Protein Vector (Mouse) (pPB-C-His)
PV243542 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-N-His)
PV243543 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-HA)
PV243544 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-His)
PV243545 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-C-His)
PV243546 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-N-His)
PV243547 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-HA)
PV243548 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-His)
PV243549 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-C-His)
PV243550 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPB-N-His)
PV243551 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-HA)
PV243552 500 ng
EUR 603
UBE2H Protein Vector (Mouse) (pPM-C-His)
PV243553 500 ng
EUR 603
UBE2H Protein Vector (Rat) (pPB-C-His)
PV314078 500 ng
EUR 603
UBE2H Protein Vector (Rat) (pPB-N-His)
PV314079 500 ng
EUR 603
UBE2H Protein Vector (Rat) (pPM-C-HA)
PV314080 500 ng
EUR 603